FvH4_6g03240

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
1803192 .. 1804402
1211 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g03240.t1

Sequence Viewer

Length: 237 bp
ATGAAGAAAAAGAATAAGCCAGAATTTCAGATCTCGGAAAAACCAACAGTTATTGGACCTCCTGGTTTGGATTTGATATCACTAGGTTTGGTTGATGAGGAGAAGTTACCAAAATATGAACTGACTGCTGAAGATGGCCAGCGGCTTGCTAAGGAGTATAGCAGGGCTACATTGAGAAGGTTAAGGAAGCTGCACGGAGGAGCAGTGAGAAGGGGAAGCTCAGATAACCAGAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.82

Weight (kDa)

9.91

Isoelectric Point (pI)

43.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 136
AcsI RAATTY 1 cut(s) 23
AcuI CTGAAG 1 cut(s) 150
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 190, 219
AluI AGCT 2 cut(s) 190, 219
AoxI GGCC 1 cut(s) 136
ApeKI GCWGC 1 cut(s) 190
ApoI RAATTY 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 56
AvaII GGWCC 1 cut(s) 56
BalI TGGCCA 1 cut(s) 138
BbvI GCAGC 1 cut(s) 177
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 1 cut(s) 83
BglII AGATCT 1 cut(s) 30
BisI GCNGC 2 cut(s) 143, 191
BlsI GCNGC 2 cut(s) 144, 192
Bme1390I CCNGG 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 56
BmgT120I GGNCC 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 63
Bpu10I CCTNAGC 1 cut(s) 150
BsaXI ACNNNNNCTCC 2 cut(s) 189, 219
BseBI CCWGG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 234
BseRI GAGGAG 2 cut(s) 113, 213
BseXI GCAGC 1 cut(s) 177
BsgI GTGCAG 1 cut(s) 176
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 30
BspACI CCGC 1 cut(s) 142
BspANI GGCC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 233
BssMI GATC 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 49
BstC8I GCNNGC 2 cut(s) 140, 147
BstDEI CTNAG 2 cut(s) 150, 220
BstKTI GATC 1 cut(s) 33
BstMBI GATC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstV1I GCAGC 1 cut(s) 177
BstX2I RGATCY 1 cut(s) 30
BstYI RGATCY 1 cut(s) 30
BsuRI GGCC 1 cut(s) 138
BtsI GCAGTG 1 cut(s) 210
BtsIMutI CAGTG 1 cut(s) 210
Cac8I GCNNGC 2 cut(s) 140, 147
Cfr13I GGNCC 1 cut(s) 56
CviJI RGCY 6 cut(s) 19, 138, 145, 167, 190, 219
CviKI_1 RGCY 6 cut(s) 19, 138, 145, 167, 190, 219
DdeI CTNAG 2 cut(s) 150, 220
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 1 cut(s) 136
Eco32I GATATC 1 cut(s) 78
Eco47I GGWCC 1 cut(s) 56
Eco57I CTGAAG 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 61
EcoRV GATATC 1 cut(s) 78
FaiI YATR 2 cut(s) 117, 159
Fnu4HI GCNGC 2 cut(s) 143, 191
Fsp4HI GCNGC 2 cut(s) 143, 191
FspBI CTAG 1 cut(s) 83
GluI GCNGC 2 cut(s) 143, 191
HaeIII GGCC 1 cut(s) 138
Hpy188I TCNGA 3 cut(s) 30, 37, 223
HpyAV CCTTC 2 cut(s) 171, 204
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 193
HpyF3I CTNAG 2 cut(s) 150, 220
Kzo9I GATC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 200
LpnPI CCDG 5 cut(s) 33, 48, 75, 148, 152
Lsp1109I GCAGC 1 cut(s) 177
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 105
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MboII GAAGA 2 cut(s) 16, 143
MflI RGATCY 1 cut(s) 30
MlsI TGGCCA 1 cut(s) 138
MluCI AATT 1 cut(s) 23
MluNI TGGCCA 1 cut(s) 138
MnlI CCTC 4 cut(s) 69, 91, 191, 225
Mox20I TGGCCA 1 cut(s) 138
MscI TGGCCA 1 cut(s) 138
MseI TTAA 1 cut(s) 182
Msp20I TGGCCA 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 142
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
NdeII GATC 1 cut(s) 30
PkrI GCNGC 2 cut(s) 144, 192
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PspPI GGNCC 1 cut(s) 56
PsuI RGATCY 1 cut(s) 30
SaqAI TTAA 1 cut(s) 182
SatI GCNGC 2 cut(s) 143, 191
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 1 cut(s) 56
ScrFI CCNGG 1 cut(s) 63
SetI ASST 6 cut(s) 61, 88, 182, 192, 221, 236
SgeI CNNG 9 cut(s) 32, 46, 74, 75, 95, 151, 158, 175, 206
SinI GGWCC 1 cut(s) 56
Sse9I AATT 1 cut(s) 23
SsiI CCGC 1 cut(s) 142
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 1 cut(s) 49
TasI AATT 1 cut(s) 23
TauI GCSGC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TscAI CASTG 1 cut(s) 210
TseI GCWGC 1 cut(s) 190
TspDTI ATGAA 2 cut(s) 17, 132
TspGWI ACGGA 1 cut(s) 210
TspRI CASTG 1 cut(s) 210
VpaK11BI GGWCC 1 cut(s) 56
XapI RAATTY 1 cut(s) 23
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.