pycom05g14480

Toll - interleukin 1 - resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0003835
Physical Location & Seq
Reverse (-)
18019459 .. 18020059
601 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g14480.2

Sequence Viewer

Length: 396 bp
ATGCCAGGAAATATTACATACTTATGTTTACAAAACACTGGTATAAAGGAGTTGCCTGAATCAGTTTGGTCTAACAAAAATATTTCTTACTTGAATATACGTCATTGCAAAGACCTTGAGAAACTTCCAAGCAACATGTGTAAAATGAAGGTTTCTAATTGTTTTAATCTAGATGGATGCACATCCCTTGGCGAGTTTTCTGAGCTTCCCAAGGATATAACCACATTATCATTGGTTGATTGCAAGAGACTTGTGAGTCTACCAACCAACCTTTGTAAGTTGAAATATGTGGAGGAACTCGATCTCTCTTGGTGCTCTAAACTTGAAGACTTCCCCAAGATCCTGAAAGTCAATGGAACATATGAAGTTCTTAAATTTAAGTGGAACAGCGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

132

Amino Acids

14.96

Weight (kDa)

8.08

Isoelectric Point (pI)

41.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 255
AccI GTMKAC 1 cut(s) 259
AciI CCGC 1 cut(s) 390
AclWI GGATC 1 cut(s) 334
AcsI RAATTY 1 cut(s) 374
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 3 cut(s) 94, 283, 326
AjnI CCWGG 1 cut(s) 4
AluBI AGCT 1 cut(s) 205
AluI AGCT 1 cut(s) 205
Alw21I GWGCWC 1 cut(s) 317
Alw26I GTCTC 1 cut(s) 241
AlwI GGATC 1 cut(s) 334
ApoI RAATTY 1 cut(s) 374
BbsI GAAGAC 1 cut(s) 333
Bbv12I GWGCWC 1 cut(s) 317
BccI CCATC 1 cut(s) 167
BciT130I CCWGG 1 cut(s) 6
BcoDI GTCTC 1 cut(s) 241
BfaI CTAG 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BmsI GCATC 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 333
BpuEI CTTGAG 1 cut(s) 137
BsaBI GATNNNNATC 1 cut(s) 181
BsaJI CCNNGG 2 cut(s) 187, 210
Bse1I ACTGG 1 cut(s) 43
Bse3DI GCAATG 1 cut(s) 103
Bse8I GATNNNNATC 1 cut(s) 181
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 2 cut(s) 187, 210
BseGI GGATG 2 cut(s) 182, 182
BseJI GATNNNNATC 1 cut(s) 181
BseMI GCAATG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 192
BseNI ACTGG 1 cut(s) 43
BsiHKAI GWGCWC 1 cut(s) 317
BsmAI GTCTC 1 cut(s) 241
Bsp1286I GDGCHC 1 cut(s) 317
Bsp143I GATC 2 cut(s) 301, 339
BspACI CCGC 1 cut(s) 390
BspCNI CTCAG 1 cut(s) 193
BspPI GGATC 1 cut(s) 334
BsrDI GCAATG 1 cut(s) 103
BsrI ACTGG 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 187, 210
BssMI GATC 2 cut(s) 301, 339
BssT1I CCWWGG 2 cut(s) 187, 210
Bst2UI CCWGG 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 201
BstF5I GGATG 2 cut(s) 182, 182
BstKTI GATC 2 cut(s) 304, 342
BstMAI GTCTC 1 cut(s) 241
BstMBI GATC 2 cut(s) 301, 339
BstNI CCWGG 1 cut(s) 6
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 4
BstV2I GAAGAC 1 cut(s) 333
BstX2I RGATCY 1 cut(s) 339
BstYI RGATCY 1 cut(s) 339
BtsCI GGATG 2 cut(s) 182, 182
BtsIMutI CAGTG 1 cut(s) 36
CviAII CATG 1 cut(s) 136
CviJI RGCY 1 cut(s) 205
CviKI_1 RGCY 1 cut(s) 205
DdeI CTNAG 1 cut(s) 201
DpnI GATC 2 cut(s) 303, 341
DpnII GATC 2 cut(s) 301, 339
DrdI GACNNNNNNGTC 1 cut(s) 255
DseDI GACNNNNNNGTC 1 cut(s) 255
Eco130I CCWWGG 2 cut(s) 187, 210
EcoRII CCWGG 1 cut(s) 4
EcoT14I CCWWGG 2 cut(s) 187, 210
ErhI CCWWGG 2 cut(s) 187, 210
FaeI CATG 1 cut(s) 139
FaiI YATR 9 cut(s) 19, 25, 44, 98, 137, 218, 288, 361, 363
FatI CATG 1 cut(s) 135
FauNDI CATATG 1 cut(s) 361
FblI GTMKAC 1 cut(s) 259
FokI GGATG 2 cut(s) 169, 189
FspBI CTAG 1 cut(s) 170
Hin1II CATG 1 cut(s) 139
HinfI GANTC 2 cut(s) 59, 256
Hpy166II GTNNAC 2 cut(s) 29, 260
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 2 cut(s) 170, 343
Hpy8I GTNNAC 2 cut(s) 29, 260
HpyAV CCTTC 1 cut(s) 142
HpyCH4IV ACGT 1 cut(s) 100
HpyCH4V TGCA 3 cut(s) 108, 180, 243
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 1 cut(s) 100
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 2 cut(s) 301, 339
LpnPI CCDG 4 cut(s) 18, 24, 69, 356
LweI GCATC 1 cut(s) 167
MaeI CTAG 1 cut(s) 170
MaeII ACGT 1 cut(s) 100
MalI GATC 2 cut(s) 303, 341
MboI GATC 2 cut(s) 301, 339
MboII GAAGA 1 cut(s) 338
MflI RGATCY 1 cut(s) 339
MhlI GDGCHC 1 cut(s) 317
MluCI AATT 2 cut(s) 157, 374
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 1 cut(s) 286
MseI TTAA 4 cut(s) 165, 372, 378, 394
MslI CAYNNNNRTG 1 cut(s) 22
MspA1I CMGCKG 1 cut(s) 390
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
NdeI CATATG 1 cut(s) 361
NdeII GATC 2 cut(s) 301, 339
NlaIII CATG 1 cut(s) 139
NspI RCATGY 1 cut(s) 139
PciI ACATGT 1 cut(s) 135
PfeI GAWTC 1 cut(s) 59
PleI GAGTC 1 cut(s) 264
PpsI GAGTC 1 cut(s) 264
PscI ACATGT 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
PsuI RGATCY 1 cut(s) 339
RseI CAYNNNNRTG 1 cut(s) 22
SaqAI TTAA 4 cut(s) 165, 372, 378, 394
Sau3AI GATC 2 cut(s) 301, 339
SchI GAGTC 1 cut(s) 265
ScrFI CCNGG 1 cut(s) 6
SduI GDGCHC 1 cut(s) 317
SetI ASST 5 cut(s) 103, 117, 153, 207, 273
SfaNI GCATC 1 cut(s) 167
SmiMI CAYNNNNRTG 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 2 cut(s) 157, 374
SsiI CCGC 1 cut(s) 390
SspI AATATT 2 cut(s) 13, 82
SspMI CTAG 1 cut(s) 170
StyD4I CCNGG 1 cut(s) 4
StyI CCWWGG 2 cut(s) 187, 210
TaiI ACGT 1 cut(s) 103
TaqI TCGA 1 cut(s) 300
TasI AATT 2 cut(s) 157, 374
TfiI GAWTC 1 cut(s) 59
Tru1I TTAA 4 cut(s) 165, 372, 378, 394
Tru9I TTAA 4 cut(s) 165, 372, 378, 394
TscAI CASTG 1 cut(s) 43
TspDTI ATGAA 2 cut(s) 161, 378
TspRI CASTG 1 cut(s) 43
XapI RAATTY 1 cut(s) 374
XbaI TCTAGA 1 cut(s) 169
XceI RCATGY 1 cut(s) 139
XcmI CCANNNNNNNNNTGG 1 cut(s) 229
XmiI GTMKAC 1 cut(s) 259
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.