Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0004544

Physical Location & Seq

Genomic Coordinates Reverse (-)

34402563 .. 34403083

Gene Structure 521 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g44671.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGACAAGGAGAAGAAGAAGAAGAAGAAGAAGAGGTCTAGCTACTGCACTCAAATTATATGAGAAAGGACATCGCACTTTAGATGATTTGAAGTATGATTATTCATTGACACATTTACAGAAGTTGGGGTTATACTACGGCATCAGGCTCAAGAGATGGATCTTCTTCTACAGAAAGATGCAGAGGATGTTTTGCTTGGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000726 GO:0003674 GO:0003824 GO:0003887 GO:0005488 GO:0006139 GO:0006259 GO:0006281 GO:0006284 GO:0006285 GO:0006289 GO:0006302 GO:0006303 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009314 GO:0009411 GO:0009416 GO:0009628 GO:0009987 GO:0010224 GO:0016740 GO:0016772 GO:0016779 GO:0016829 GO:0016835 GO:0018130 GO:0019438 GO:0030145 GO:0033554 GO:0034061 GO:0034641 GO:0034645 GO:0034654 GO:0043167 GO:0043169 GO:0043170 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0046483 GO:0046872 GO:0046914 GO:0050896 GO:0051575 GO:0051716 GO:0071704 GO:0071897 GO:0090304 GO:0097510 GO:0140097 GO:1901360 GO:1901362 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko03410 ko03450 map03410 map03450

Pfam Domains

Protein Families

BRCT DNA_pol_B_palm DNA_pol_B_thumb DNA_pol_lambd_f HHH_8 LIM

Protein Analysis

68

Amino Acids

8.47

Weight (kDa)

11.34

Isoelectric Point (pI)

97.9

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DNA_pol_lambd_f	PF10391	12 - 46	1.4e-08	Fingers domain of DNA polymerase lambda

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004544)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g23350 FvH4_6g44671
malus_domestica	MD07G1310100.v1.1
prunus_persica	Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1
pyrus_communis	pycom07g28220
rosa_chinensis	RchiOBHm_Chr1g0384481 RchiOBHm_Chr3g0484611
rosa_laevigata	RLG00000026038
rosa_multiflora	Rmu_co8409505.1_g000001 Rmu_sc0006005.1_g000002 Rmu_sc0027852.1_g000001
rosa_roxburghii	Rroxscaffold_4G00276670 Rroxscaffold_5G00378750 Rroxscaffold_7G00193860
rosa_rugosa	Rorug01G0448000 Rorug01G0448100 Rorug05G0567200
rosa_samantha	Rh1CG444500 Rh2DG337500 Rh2DG481000 Rh3AG228400 Rh7AG441300
rosa_wichuraiana	Rw0G003890 Rw1G039930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	167
AgsI	TTSAA	1 cut(s)	91
AluBI	AGCT	1 cut(s)	41
AluI	AGCT	1 cut(s)	41
AlwI	GGATC	1 cut(s)	167
BccI	CCATC	1 cut(s)	150
BceAI	ACGGC	1 cut(s)	154
BfaI	CTAG	1 cut(s)	38
BfmI	CTRYAG	1 cut(s)	169
BmsI	GCATC	2 cut(s)	150, 168
BpuEI	CTTGAG	1 cut(s)	134
BseGI	GGATG	1 cut(s)	192
BsgI	GTGCAG	1 cut(s)	30
Bsp143I	GATC	1 cut(s)	159
BspPI	GGATC	1 cut(s)	167
BssMI	GATC	1 cut(s)	159
Bst6I	CTCTTC	1 cut(s)	25
BstF5I	GGATG	1 cut(s)	192
BstKTI	GATC	1 cut(s)	162
BstMBI	GATC	1 cut(s)	159
BstSFI	CTRYAG	1 cut(s)	169
BstX2I	RGATCY	1 cut(s)	159
BstYI	RGATCY	1 cut(s)	159
BtgZI	GCGATG	1 cut(s)	56
BtsCI	GGATG	1 cut(s)	192
CviJI	RGCY	2 cut(s)	41, 148
CviKI_1	RGCY	2 cut(s)	41, 148
DpnI	GATC	1 cut(s)	161
DpnII	GATC	1 cut(s)	159
Eam1104I	CTCTTC	1 cut(s)	25
EarI	CTCTTC	1 cut(s)	25
FaiI	YATR	4 cut(s)	58, 60, 96, 133
FokI	GGATG	1 cut(s)	199
FspBI	CTAG	1 cut(s)	38
Hpy188III	TCNNGA	1 cut(s)	151
HpyCH4V	TGCA	2 cut(s)	47, 181
Kzo9I	GATC	1 cut(s)	159
LpnPI	CCDG	1 cut(s)	130
LweI	GCATC	2 cut(s)	150, 168
MaeI	CTAG	1 cut(s)	38
MalI	GATC	1 cut(s)	161
MboI	GATC	1 cut(s)	159
MboII	GAAGA	9 cut(s)	24, 27, 30, 33, 36, 39, 42, 154, 157
MflI	RGATCY	1 cut(s)	159
MluCI	AATT	1 cut(s)	53
MnlI	CCTC	2 cut(s)	26, 177
NdeII	GATC	1 cut(s)	159
PsuI	RGATCY	1 cut(s)	159
Sau3AI	GATC	1 cut(s)	159
SetI	ASST	2 cut(s)	37, 43
SfaNI	GCATC	2 cut(s)	150, 168
SfcI	CTRYAG	1 cut(s)	169
SgeI	CNNG	4 cut(s)	18, 50, 157, 163
SmlI	CTYRAG	1 cut(s)	149
SmoI	CTYRAG	1 cut(s)	149
Sse9I	AATT	1 cut(s)	53
SspMI	CTAG	1 cut(s)	38
TasI	AATT	1 cut(s)	53
TspDTI	ATGAA	1 cut(s)	93
XspI	CTAG	1 cut(s)	38

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.