Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3A

Orthogroup ID

OG0004544

Physical Location & Seq

Genomic Coordinates Forward (+)

23512231 .. 23514478

Gene Structure 2248 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3AG228400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

ATGAGGCTCAAGAGATGGAACTTCTTCTATAAAAAGCAGCAGAGGATGTTTTGCCTGGGTCCAGACATTGGTGACATTATTGGCCTTGAATTAAAACGAGATAATGCACTTATTGCTGCTAATATTGAGCGTTCTTCACTTGTTTTATGTGGCAATGCATTCTCAGATTCAAATGCAACTAAAGAAGCACTAGCTGTCTTGTCCATATCTGTTATATTTGCCCGAAGAGGCCTTCCCCTATCTGCAAGCTCTGGTAGCTCAAATCTATTCAAGTTGCCAGCTGCTGCAGTCCTTGCAACTTTTGACAGTGATTTTGCTTACAACTATCTTGGGAGATGGGGCAAATTGTATTCTTTTTTATTATCATGTAAAGCTCATGAAACTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PEPCK_ATP

Protein Analysis

128

Amino Acids

14.18

Weight (kDa)

9.47

Isoelectric Point (pI)

53.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004544)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g23350 FvH4_6g44671
malus_domestica	MD07G1310100.v1.1
prunus_persica	Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1
pyrus_communis	pycom07g28220
rosa_chinensis	RchiOBHm_Chr1g0384481 RchiOBHm_Chr3g0484611
rosa_laevigata	RLG00000026038
rosa_multiflora	Rmu_co8409505.1_g000001 Rmu_sc0006005.1_g000002 Rmu_sc0027852.1_g000001
rosa_roxburghii	Rroxscaffold_4G00276670 Rroxscaffold_5G00378750 Rroxscaffold_7G00193860
rosa_rugosa	Rorug01G0448000 Rorug01G0448100 Rorug05G0567200
rosa_samantha	Rh1CG444500 Rh2DG337500 Rh2DG481000 Rh3AG228400 Rh7AG441300
rosa_wichuraiana	Rw0G003890 Rw1G039930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	68
AfiI	CCNNNNNNNGG	1 cut(s)	68
AgsI	TTSAA	3 cut(s)	89, 171, 271
AjnI	CCWGG	1 cut(s)	54
AluBI	AGCT	5 cut(s)	194, 249, 258, 281, 374
AluI	AGCT	5 cut(s)	194, 249, 258, 281, 374
AlwNI	CAGNNNCTG	1 cut(s)	284
AoxI	GGCC	2 cut(s)	82, 229
ApeKI	GCWGC	4 cut(s)	37, 116, 281, 284
ArsI	GACNNNNNNTTYG	2 cut(s)	296, 328
Asp700I	GAANNNNTTC	1 cut(s)	23
AspS9I	GGNCC	1 cut(s)	59
AsuHPI	GGTGA	1 cut(s)	83
AvaII	GGWCC	1 cut(s)	59
BbvI	GCAGC	4 cut(s)	49, 103, 268, 271
BccI	CCATC	2 cut(s)	9, 330
BciT130I	CCWGG	1 cut(s)	56
BfaI	CTAG	1 cut(s)	191
BfmI	CTRYAG	1 cut(s)	285
BisI	GCNGC	4 cut(s)	38, 117, 282, 285
BlsI	GCNGC	4 cut(s)	39, 118, 283, 286
Bme1390I	CCNGG	1 cut(s)	56
Bme18I	GGWCC	1 cut(s)	59
BmgT120I	GGNCC	1 cut(s)	59
BmiI	GGNNCC	1 cut(s)	60
BmrFI	CCNGG	1 cut(s)	56
BsaJI	CCNNGG	1 cut(s)	55
Bsc4I	CCNNNNNNNGG	1 cut(s)	68
Bse3DI	GCAATG	1 cut(s)	160
BseBI	CCWGG	1 cut(s)	56
BseDI	CCNNGG	1 cut(s)	55
BseGI	GGATG	1 cut(s)	51
BseLI	CCNNNNNNNGG	1 cut(s)	68
BseMI	GCAATG	1 cut(s)	160
BseMII	CTCAG	1 cut(s)	177
BseXI	GCAGC	4 cut(s)	49, 103, 268, 271
BshFI	GGCC	2 cut(s)	84, 231
BslI	CCNNNNNNNGG	1 cut(s)	68
BsmI	GAATGC	1 cut(s)	158
BsnI	GGCC	2 cut(s)	84, 231
BspANI	GGCC	2 cut(s)	84, 231
BspCNI	CTCAG	1 cut(s)	176
BspHI	TCATGA	1 cut(s)	376
BspLI	GGNNCC	1 cut(s)	60
BspMAI	CTGCAG	1 cut(s)	289
BsrDI	GCAATG	1 cut(s)	160
BssECI	CCNNGG	1 cut(s)	55
Bst2UI	CCWGG	1 cut(s)	56
Bst4CI	ACNGT	1 cut(s)	308
Bst6I	CTCTTC	1 cut(s)	220
BstAPI	GCANNNNNTGC	2 cut(s)	113, 293
BstC8I	GCNNGC	2 cut(s)	247, 279
BstDEI	CTNAG	1 cut(s)	163
BstF5I	GGATG	1 cut(s)	51
BstMWI	GCNNNNNNNGC	3 cut(s)	113, 255, 293
BstNI	CCWGG	1 cut(s)	56
BstSCI	CCNGG	1 cut(s)	54
BstSFI	CTRYAG	1 cut(s)	285
BstV1I	GCAGC	4 cut(s)	49, 103, 268, 271
BsuRI	GGCC	2 cut(s)	84, 231
BtsCI	GGATG	1 cut(s)	51
BtsIMutI	CAGTG	1 cut(s)	313
Cac8I	GCNNGC	2 cut(s)	247, 279
CaiI	CAGNNNCTG	1 cut(s)	284
CciI	TCATGA	1 cut(s)	376
Cfr13I	GGNCC	1 cut(s)	59
CviAII	CATG	2 cut(s)	366, 377
CviJI	RGCY	8 cut(s)	7, 84, 194, 231, 249, 258, 281, 374
CviKI_1	RGCY	8 cut(s)	7, 84, 194, 231, 249, 258, 281, 374
DdeI	CTNAG	1 cut(s)	163
Eam1104I	CTCTTC	1 cut(s)	220
EarI	CTCTTC	1 cut(s)	220
Eco147I	AGGCCT	1 cut(s)	231
Eco47I	GGWCC	1 cut(s)	59
EcoRII	CCWGG	1 cut(s)	54
EcoT22I	ATGCAT	1 cut(s)	160
FaeI	CATG	2 cut(s)	369, 380
FaiI	YATR	6 cut(s)	30, 148, 206, 215, 367, 378
FatI	CATG	2 cut(s)	365, 376
Fnu4HI	GCNGC	4 cut(s)	38, 117, 282, 285
FokI	GGATG	1 cut(s)	58
Fsp4HI	GCNGC	4 cut(s)	38, 117, 282, 285
FspBI	CTAG	1 cut(s)	191
GluI	GCNGC	4 cut(s)	38, 117, 282, 285
HaeIII	GGCC	2 cut(s)	84, 231
Hin1II	CATG	2 cut(s)	369, 380
HinfI	GANTC	1 cut(s)	167
HphI	GGTGA	1 cut(s)	83
Hpy188I	TCNGA	1 cut(s)	166
Hpy188III	TCNNGA	3 cut(s)	10, 62, 377
HpyAV	CCTTC	1 cut(s)	242
HpyCH4III	ACNGT	1 cut(s)	308
HpyCH4V	TGCA	6 cut(s)	107, 158, 176, 245, 287, 296
HpyF10VI	GCNNNNNNNGC	3 cut(s)	113, 255, 293
HpyF3I	CTNAG	1 cut(s)	163
Hsp92II	CATG	2 cut(s)	369, 380
LpnPI	CCDG	5 cut(s)	41, 68, 75, 237, 291
Lsp1109I	GCAGC	4 cut(s)	49, 103, 268, 271
MaeI	CTAG	1 cut(s)	191
MaeIII	GTNAC	1 cut(s)	71
MboII	GAAGA	3 cut(s)	16, 126, 237
MluCI	AATT	2 cut(s)	89, 344
MnlI	CCTC	2 cut(s)	36, 221
Mph1103I	ATGCAT	1 cut(s)	160
MroXI	GAANNNNTTC	1 cut(s)	23
MseI	TTAA	1 cut(s)	92
MspA1I	CMGCKG	1 cut(s)	281
MspR9I	CCNGG	1 cut(s)	56
Mva1269I	GAATGC	1 cut(s)	158
MvaI	CCWGG	1 cut(s)	56
MwoI	GCNNNNNNNGC	3 cut(s)	113, 255, 293
NlaIII	CATG	2 cut(s)	369, 380
NlaIV	GGNNCC	1 cut(s)	60
NmuCI	GTSAC	1 cut(s)	71
NsiI	ATGCAT	1 cut(s)	160
PagI	TCATGA	1 cut(s)	376
PceI	AGGCCT	1 cut(s)	231
PctI	GAATGC	1 cut(s)	158
PdmI	GAANNNNTTC	1 cut(s)	23
PfeI	GAWTC	1 cut(s)	167
PflMI	CCANNNNNTGG	1 cut(s)	68
PkrI	GCNGC	4 cut(s)	39, 118, 283, 286
Psp6I	CCWGG	1 cut(s)	54
PspGI	CCWGG	1 cut(s)	54
PspN4I	GGNNCC	1 cut(s)	60
PspPI	GGNCC	1 cut(s)	59
PstI	CTGCAG	1 cut(s)	289
PstNI	CAGNNNCTG	1 cut(s)	284
PvuII	CAGCTG	1 cut(s)	281
SaqAI	TTAA	1 cut(s)	92
SatI	GCNGC	4 cut(s)	38, 117, 282, 285
Sau96I	GGNCC	1 cut(s)	59
ScrFI	CCNGG	1 cut(s)	56
SetI	ASST	5 cut(s)	196, 251, 260, 283, 376
SfcI	CTRYAG	1 cut(s)	285
SinI	GGWCC	1 cut(s)	59
SmlI	CTYRAG	1 cut(s)	8
SmoI	CTYRAG	1 cut(s)	8
Sse9I	AATT	2 cut(s)	89, 344
SseBI	AGGCCT	1 cut(s)	231
SspI	AATATT	1 cut(s)	124
SspMI	CTAG	1 cut(s)	191
StuI	AGGCCT	1 cut(s)	231
StyD4I	CCNGG	1 cut(s)	54
TaaI	ACNGT	1 cut(s)	308
TasI	AATT	2 cut(s)	89, 344
TfiI	GAWTC	1 cut(s)	167
Tru1I	TTAA	1 cut(s)	92
Tru9I	TTAA	1 cut(s)	92
TscAI	CASTG	1 cut(s)	313
TseFI	GTSAC	1 cut(s)	71
TseI	GCWGC	4 cut(s)	37, 116, 281, 284
Tsp45I	GTSAC	1 cut(s)	71
TspRI	CASTG	1 cut(s)	313
Van91I	CCANNNNNTGG	1 cut(s)	68
VpaK11BI	GGWCC	1 cut(s)	59
XmnI	GAANNNNTTC	1 cut(s)	23
XspI	CTAG	1 cut(s)	191
Zsp2I	ATGCAT	1 cut(s)	160

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.