Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp02

Orthogroup ID

OG0004544

Physical Location & Seq

Genomic Coordinates Forward (+)

30179410 .. 30183401

Gene Structure 3992 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.2G328000.7

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1332 bp

ATGTCTCAATGCTTCAACGTCTCAATGTCTCAACGTCTCAATGCCTCAATGTCTCAATGTCTCAGTGCCTCAGCTCACAATATTTCTATCATTTGTCACAGACTCACAGACAGTCCACTTTTGGTATTGCCTACTACCATCTTCTTTTTTGCAGGGAGGGTTATTGATTATTCTTATGGCCTTAACTTGGCTTTGGCTGGAAAAGGTGTAATTGTCAAGGACCAAGCTTTTCTAAATTTGAACTCCTCTCAACTACAACACAAGGGTGCAACAATTGCAGAATCATTGTCAGGGCTTCCGCTTCTTGTTAGAGGACATGTCCCTGGAGGAGGACCTTCTGAAATTTCCAAGCCACACTTCACTAAACTTTTAAAACAGGTCACAAATCATATATCATCCATCTCAAACATTTTTGTTCATGACGGGGCTATTGGTTCATCACCAAAATGTGATGTGAAAGTTCGTTTAATAAGTGATAATCCGTCTGCGATGCTGTCACTATCCCATATGCTCTGGGAGACTCCCACCCGTGCAGTTTCTCAGGATTCATGTCCTTTAACAGTTTATGTGGCTACTTCTATAAGTCCAGGCATTGGGGAAAGTATTGGCCTTGGATCCAAAGAAAATGATGGATTCATAGCTGCTGATATTGAACGCTCATCACTTATTTTATGTGGTAAAGCGTTCTCAGATTCAAATACAACTAAAGAAGCACTAGCTGCCTTGTCTTGGCCTGTTATATTTGCAAGAGGAGGCCTTCCATTATCTGCAAGGCTTTTAGTGTCTGGTGATTCTGTGGTTCTTTTATTTGCACCCAAAAGGACCTTTAAGAGTTGCAGAGATCTGTTGGTGCCTTCAGATGCAGGTGTAATTCTTTATTCTAATGGTCTGGGCTTTTTGTTTCAAACTGGTGGATCAAATCTATTCAAATTGCCAGCTTCTGTATTCCTTGCATCTTCTGACAGTTCTGGTGTTATCCCTTCTGTTTCAAAGCTCTCCCCTGGCCAGGCAGCTTATCACTTCTTGGCTGGTTATCAGAATGGGAAGTTCATACCTGCATACAACAAAGGCACTTGGTCCATTGACCCGTTGGAACTAGCTAAGGCGTTTATGTCTAAGTTGAAAGATGACCAGATCTCATCTTACCTGTTCAATGTCAATGGAGGAGAAAATAATGTAAATGGCAAGGATTTTGCTAAGGTGGTGCAATCAACGTTGTCCGAGAACATCCCACCATTTCAAGCTAAAAATACTCATTCAAAGATCATCTCTACAAAAAATCACTTGAATCCGATATCATGTGACCACTCAATTGAGTTATTGAAATTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PEPCK_ATP

Protein Analysis

444

Amino Acids

47.32

Weight (kDa)

8.9

Isoelectric Point (pI)

43.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004544)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g23350 FvH4_6g44671
malus_domestica	MD07G1310100.v1.1
prunus_persica	Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1 Prupe.2G328000_v2.0.a1
pyrus_communis	pycom07g28220
rosa_chinensis	RchiOBHm_Chr1g0384481 RchiOBHm_Chr3g0484611
rosa_laevigata	RLG00000026038
rosa_multiflora	Rmu_co8409505.1_g000001 Rmu_sc0006005.1_g000002 Rmu_sc0027852.1_g000001
rosa_roxburghii	Rroxscaffold_4G00276670 Rroxscaffold_5G00378750 Rroxscaffold_7G00193860
rosa_rugosa	Rorug01G0448000 Rorug01G0448100 Rorug05G0567200
rosa_samantha	Rh1CG444500 Rh2DG337500 Rh2DG481000 Rh3AG228400 Rh7AG441300
rosa_wichuraiana	Rw0G003890 Rw1G039930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	854
Acc36I	ACCTGC	2 cut(s)	854, 1063
AccB1I	GGYRCC	1 cut(s)	850
AccB7I	CCANNNNNTGG	1 cut(s)	593
AciI	CCGC	1 cut(s)	299
AclI	AACGTT	1 cut(s)	1214
AclWI	GGATC	3 cut(s)	609, 622, 922
AcoI	YGGCCR	1 cut(s)	1003
AcsI	RAATTY	3 cut(s)	235, 342, 1325
AcuI	CTGAAG	1 cut(s)	840
AfiI	CCNNNNNNNGG	5 cut(s)	187, 329, 593, 729, 1006
AflIII	ACRYGT	1 cut(s)	316
AjnI	CCWGG	4 cut(s)	322, 586, 1000, 1005
AjuI	GAANNNNNNNTTGG	2 cut(s)	341, 373
AleI	CACNNNNGTG	1 cut(s)	264
AluBI	AGCT	9 cut(s)	74, 227, 641, 719, 938, 994, 1013, 1100, 1244
AluI	AGCT	9 cut(s)	74, 227, 641, 719, 938, 994, 1013, 1100, 1244
Alw26I	GTCTC	7 cut(s)	9, 25, 33, 41, 57, 65, 512
AlwI	GGATC	3 cut(s)	609, 622, 922
AlwNI	CAGNNNCTG	1 cut(s)	941
AoxI	GGCC	5 cut(s)	178, 607, 731, 754, 1003
ApeKI	GCWGC	3 cut(s)	641, 719, 1010
ApoI	RAATTY	3 cut(s)	235, 342, 1325
AspS9I	GGNCC	4 cut(s)	220, 332, 822, 1077
AsuHPI	GGTGA	2 cut(s)	432, 800
AvaII	GGWCC	4 cut(s)	220, 332, 822, 1077
BalI	TGGCCA	1 cut(s)	1005
BamHI	GGATCC	1 cut(s)	614
BanI	GGYRCC	1 cut(s)	850
BbvCI	CCTCAGC	1 cut(s)	70
BbvI	GCAGC	3 cut(s)	628, 706, 1022
BccI	CCATC	3 cut(s)	146, 407, 623
BciT130I	CCWGG	4 cut(s)	324, 588, 1002, 1007
BcoDI	GTCTC	7 cut(s)	9, 25, 33, 41, 57, 65, 512
BfaI	CTAG	2 cut(s)	716, 1097
BfuAI	ACCTGC	2 cut(s)	854, 1063
BglII	AGATCT	2 cut(s)	841, 1134
BisI	GCNGC	3 cut(s)	642, 720, 1011
BlsI	GCNGC	3 cut(s)	643, 721, 1012
Bme1390I	CCNGG	4 cut(s)	324, 588, 1002, 1007
Bme18I	GGWCC	4 cut(s)	220, 332, 822, 1077
BmgT120I	GGNCC	4 cut(s)	220, 332, 822, 1077
BmiI	GGNNCC	2 cut(s)	616, 852
BmrFI	CCNGG	4 cut(s)	324, 588, 1002, 1007
BmsI	GCATC	3 cut(s)	480, 850, 962
BpmI	CTGGAG	1 cut(s)	345
Bpu10I	CCTNAGC	3 cut(s)	70, 1101, 1197
BsaJI	CCNNGG	3 cut(s)	322, 610, 1000
Bsc4I	CCNNNNNNNGG	5 cut(s)	187, 329, 593, 729, 1006
Bse1I	ACTGG	1 cut(s)	913
BseBI	CCWGG	4 cut(s)	324, 588, 1002, 1007
BseDI	CCNNGG	3 cut(s)	322, 610, 1000
BseGI	GGATG	2 cut(s)	395, 1227
BseLI	CCNNNNNNNGG	5 cut(s)	187, 329, 593, 729, 1006
BseMII	CTCAG	4 cut(s)	76, 84, 554, 702
BseNI	ACTGG	1 cut(s)	913
BseRI	GAGGAG	4 cut(s)	235, 342, 765, 1179
BseXI	GCAGC	3 cut(s)	628, 706, 1022
BsgI	GTGCAG	1 cut(s)	552
BshFI	GGCC	5 cut(s)	180, 609, 733, 756, 1005
BshNI	GGYRCC	1 cut(s)	850
BslFI	GGGAC	1 cut(s)	305
BslI	CCNNNNNNNGG	5 cut(s)	187, 329, 593, 729, 1006
BsmAI	GTCTC	7 cut(s)	9, 25, 33, 41, 57, 65, 512
BsmBI	CGTCTC	2 cut(s)	25, 41
BsmFI	GGGAC	1 cut(s)	305
BsnI	GGCC	5 cut(s)	180, 609, 733, 756, 1005
Bsp143I	GATC	5 cut(s)	614, 841, 914, 1134, 1263
BspACI	CCGC	1 cut(s)	299
BspANI	GGCC	5 cut(s)	180, 609, 733, 756, 1005
BspCNI	CTCAG	4 cut(s)	75, 83, 553, 701
BspHI	TCATGA	1 cut(s)	418
BspLI	GGNNCC	2 cut(s)	616, 852
BspMI	ACCTGC	2 cut(s)	854, 1063
BspPI	GGATC	3 cut(s)	609, 622, 922
BspT107I	GGYRCC	1 cut(s)	850
BsrI	ACTGG	1 cut(s)	913
BssECI	CCNNGG	3 cut(s)	322, 610, 1000
BssMI	GATC	5 cut(s)	614, 841, 914, 1134, 1263
BssT1I	CCWWGG	1 cut(s)	610
Bst2UI	CCWGG	4 cut(s)	324, 588, 1002, 1007
Bst4CI	ACNGT	3 cut(s)	113, 562, 965
BstAPI	GCANNNNNTGC	2 cut(s)	275, 719
BstC8I	GCNNGC	1 cut(s)	936
BstDEI	CTNAG	7 cut(s)	62, 70, 540, 688, 1101, 1116, 1197
BstENI	CCTNNNNNAGG	1 cut(s)	327
BstF5I	GGATG	2 cut(s)	395, 1227
BstKTI	GATC	5 cut(s)	617, 844, 917, 1137, 1266
BstMAI	GTCTC	7 cut(s)	9, 25, 33, 41, 57, 65, 512
BstMBI	GATC	5 cut(s)	614, 841, 914, 1134, 1263
BstMWI	GCNNNNNNNGC	2 cut(s)	275, 719
BstNI	CCWGG	4 cut(s)	324, 588, 1002, 1007
BstNSI	RCATGY	1 cut(s)	320
BstSCI	CCNGG	4 cut(s)	322, 586, 1000, 1005
BstV1I	GCAGC	3 cut(s)	628, 706, 1022
BstX2I	RGATCY	3 cut(s)	614, 841, 1134
BstYI	RGATCY	3 cut(s)	614, 841, 1134
BsuRI	GGCC	5 cut(s)	180, 609, 733, 756, 1005
BtgZI	GCGATG	1 cut(s)	503
BtsCI	GGATG	2 cut(s)	395, 1227
BtsIMutI	CAGTG	1 cut(s)	70
BveI	ACCTGC	2 cut(s)	854, 1063
Cac8I	GCNNGC	1 cut(s)	936
CaiI	CAGNNNCTG	1 cut(s)	941
CciI	TCATGA	1 cut(s)	418
Cfr13I	GGNCC	4 cut(s)	220, 332, 822, 1077
CviAII	CATG	4 cut(s)	317, 419, 549, 1299
DdeI	CTNAG	7 cut(s)	62, 70, 540, 688, 1101, 1116, 1197
DpnI	GATC	5 cut(s)	616, 843, 916, 1136, 1265
DpnII	GATC	5 cut(s)	614, 841, 914, 1134, 1263
DraI	TTTAAA	1 cut(s)	372
EaeI	YGGCCR	1 cut(s)	1003
Eco130I	CCWWGG	1 cut(s)	610
Eco147I	AGGCCT	1 cut(s)	756
Eco32I	GATATC	1 cut(s)	1296
Eco47I	GGWCC	4 cut(s)	220, 332, 822, 1077
Eco57I	CTGAAG	1 cut(s)	840
EcoNI	CCTNNNNNAGG	1 cut(s)	327
EcoO109I	RGGNCCY	2 cut(s)	332, 822
EcoRII	CCWGG	4 cut(s)	322, 586, 1000, 1005
EcoRV	GATATC	1 cut(s)	1296
EcoT14I	CCWWGG	1 cut(s)	610
ErhI	CCWWGG	1 cut(s)	610
Esp3I	CGTCTC	2 cut(s)	25, 41
FaeI	CATG	4 cut(s)	320, 422, 552, 1302
FalI	AAGNNNNNCTT	2 cut(s)	341, 373
FaqI	GGGAC	1 cut(s)	305
FatI	CATG	4 cut(s)	316, 418, 548, 1298
FauNDI	CATATG	1 cut(s)	507
Fnu4HI	GCNGC	3 cut(s)	642, 720, 1011
FokI	GGATG	2 cut(s)	382, 1214
Fsp4HI	GCNGC	3 cut(s)	642, 720, 1011
FspBI	CTAG	2 cut(s)	716, 1097
GluI	GCNGC	3 cut(s)	642, 720, 1011
GsuI	CTGGAG	1 cut(s)	345
HaeIII	GGCC	5 cut(s)	180, 609, 733, 756, 1005
Hin1II	CATG	4 cut(s)	320, 422, 552, 1302
HindIII	AAGCTT	1 cut(s)	225
HinfI	GANTC	8 cut(s)	102, 281, 520, 545, 633, 692, 791, 1288
HphI	GGTGA	2 cut(s)	432, 800
Hpy166II	GTNNAC	1 cut(s)	116
Hpy188I	TCNGA	7 cut(s)	340, 691, 859, 961, 1038, 1222, 1293
Hpy188III	TCNNGA	2 cut(s)	419, 542
Hpy8I	GTNNAC	1 cut(s)	116
HpyAV	CCTTC	4 cut(s)	345, 767, 864, 990
HpyCH4III	ACNGT	3 cut(s)	113, 562, 965
HpyCH4IV	ACGT	3 cut(s)	18, 34, 1214
HpyF10VI	GCNNNNNNNGC	2 cut(s)	275, 719
HpyF3I	CTNAG	7 cut(s)	62, 70, 540, 688, 1101, 1116, 1197
HpySE526I	ACGT	3 cut(s)	18, 34, 1214
Hsp92II	CATG	4 cut(s)	320, 422, 552, 1302
Kzo9I	GATC	5 cut(s)	614, 841, 914, 1134, 1263
Lsp1109I	GCAGC	3 cut(s)	628, 706, 1022
LweI	GCATC	3 cut(s)	480, 850, 962
MaeI	CTAG	2 cut(s)	716, 1097
MaeII	ACGT	3 cut(s)	18, 34, 1214
MaeIII	GTNAC	4 cut(s)	95, 379, 495, 1301
MalI	GATC	5 cut(s)	616, 843, 916, 1136, 1265
MboI	GATC	5 cut(s)	614, 841, 914, 1134, 1263
MboII	GAAGA	2 cut(s)	133, 948
MfeI	CAATTG	2 cut(s)	273, 1311
MflI	RGATCY	3 cut(s)	614, 841, 1134
MlsI	TGGCCA	1 cut(s)	1005
MluCI	AATT	8 cut(s)	210, 235, 273, 342, 870, 929, 1311, 1325
MluNI	TGGCCA	1 cut(s)	1005
MlyI	GAGTC	2 cut(s)	96, 514
MmeI	TCCRAC	1 cut(s)	1071
Mox20I	TGGCCA	1 cut(s)	1005
MscI	TGGCCA	1 cut(s)	1005
MseI	TTAA	5 cut(s)	183, 371, 467, 557, 828
MslI	CAYNNNNRTG	2 cut(s)	264, 445
Msp20I	TGGCCA	1 cut(s)	1005
MspR9I	CCNGG	4 cut(s)	324, 588, 1002, 1007
MunI	CAATTG	2 cut(s)	273, 1311
MvaI	CCWGG	4 cut(s)	324, 588, 1002, 1007
MwoI	GCNNNNNNNGC	2 cut(s)	275, 719
NdeI	CATATG	1 cut(s)	507
NdeII	GATC	5 cut(s)	614, 841, 914, 1134, 1263
NlaIII	CATG	4 cut(s)	320, 422, 552, 1302
NlaIV	GGNNCC	2 cut(s)	616, 852
NmuCI	GTSAC	4 cut(s)	95, 379, 495, 1301
NspI	RCATGY	1 cut(s)	320
OliI	CACNNNNGTG	1 cut(s)	264
PagI	TCATGA	1 cut(s)	418
PaqCI	CACCTGC	1 cut(s)	854
PceI	AGGCCT	1 cut(s)	756
PciI	ACATGT	1 cut(s)	316
PfeI	GAWTC	6 cut(s)	281, 545, 633, 692, 791, 1288
PflMI	CCANNNNNTGG	1 cut(s)	593
PkrI	GCNGC	3 cut(s)	643, 721, 1012
PleI	GAGTC	2 cut(s)	96, 514
PpsI	GAGTC	2 cut(s)	96, 514
PpuMI	RGGWCCY	2 cut(s)	332, 822
PscI	ACATGT	1 cut(s)	316
Psp1406I	AACGTT	1 cut(s)	1214
Psp5II	RGGWCCY	2 cut(s)	332, 822
Psp6I	CCWGG	4 cut(s)	322, 586, 1000, 1005
PspGI	CCWGG	4 cut(s)	322, 586, 1000, 1005
PspN4I	GGNNCC	2 cut(s)	616, 852
PspPI	GGNCC	4 cut(s)	220, 332, 822, 1077
PspPPI	RGGWCCY	2 cut(s)	332, 822
PstNI	CAGNNNCTG	1 cut(s)	941
PsuI	RGATCY	3 cut(s)	614, 841, 1134
RseI	CAYNNNNRTG	2 cut(s)	264, 445
SaqAI	TTAA	5 cut(s)	183, 371, 467, 557, 828
SatI	GCNGC	3 cut(s)	642, 720, 1011
Sau3AI	GATC	5 cut(s)	614, 841, 914, 1134, 1263
Sau96I	GGNCC	4 cut(s)	220, 332, 822, 1077
SchI	GAGTC	2 cut(s)	96, 514
ScrFI	CCNGG	4 cut(s)	324, 588, 1002, 1007
SfaNI	GCATC	3 cut(s)	480, 850, 962
SinI	GGWCC	4 cut(s)	220, 332, 822, 1077
SmiMI	CAYNNNNRTG	2 cut(s)	264, 445
Sse9I	AATT	8 cut(s)	210, 235, 273, 342, 870, 929, 1311, 1325
SseBI	AGGCCT	1 cut(s)	756
SsiI	CCGC	1 cut(s)	299
SspI	AATATT	1 cut(s)	82
SspMI	CTAG	2 cut(s)	716, 1097
StuI	AGGCCT	1 cut(s)	756
StyD4I	CCNGG	4 cut(s)	322, 586, 1000, 1005
StyI	CCWWGG	1 cut(s)	610
TaaI	ACNGT	3 cut(s)	113, 562, 965
TaiI	ACGT	3 cut(s)	21, 37, 1217
TasI	AATT	8 cut(s)	210, 235, 273, 342, 870, 929, 1311, 1325
TfiI	GAWTC	6 cut(s)	281, 545, 633, 692, 791, 1288
Tru1I	TTAA	5 cut(s)	183, 371, 467, 557, 828
Tru9I	TTAA	5 cut(s)	183, 371, 467, 557, 828
TscAI	CASTG	1 cut(s)	70
TseFI	GTSAC	4 cut(s)	95, 379, 495, 1301
TseI	GCWGC	3 cut(s)	641, 719, 1010
Tsp45I	GTSAC	4 cut(s)	95, 379, 495, 1301
TspDTI	ATGAA	5 cut(s)	407, 426, 537, 625, 1039
TspGWI	ACGGA	1 cut(s)	471
TspRI	CASTG	1 cut(s)	70
Van91I	CCANNNNNTGG	1 cut(s)	593
VpaK11BI	GGWCC	4 cut(s)	220, 332, 822, 1077
XagI	CCTNNNNNAGG	1 cut(s)	327
XapI	RAATTY	3 cut(s)	235, 342, 1325
XceI	RCATGY	1 cut(s)	320
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1087
XspI	CTAG	2 cut(s)	716, 1097

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.