Rh7AG441300

Phosphoenolpyruvate carboxykinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
59813209 .. 59831044
17836 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG441300.1

Sequence Viewer

Length: 165 bp
ATGCCTGCCCTATTTATGGGTTGTGGAGATTTGTTGGTGCCAGGAGAAGTAGGAGTTATTCGTTCTTCTGAAGGTGTTGCCCCAATGTTTCAAACTGGAAGCTCTGGTAGCTCAAATCTATTCAAGTTGCTAGCTGCTGCAGTCCTTGCAACTTTTGACAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.52

Weight (kDa)

4.78

Isoelectric Point (pI)

43.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 37
AcuI CTGAAG 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 16
AgsI TTSAA 2 cut(s) 92, 124
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 3 cut(s) 102, 111, 134
AluI AGCT 3 cut(s) 102, 111, 134
ApeKI GCWGC 2 cut(s) 134, 137
AsuNHI GCTAGC 1 cut(s) 130
BanI GGYRCC 1 cut(s) 37
BbvI GCAGC 2 cut(s) 121, 124
BciT130I CCWGG 1 cut(s) 42
BfaI CTAG 1 cut(s) 131
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 2 cut(s) 135, 138
BlsI GCNGC 2 cut(s) 136, 139
Bme1390I CCNGG 1 cut(s) 42
BmiI GGNNCC 1 cut(s) 39
BmrFI CCNGG 1 cut(s) 42
BmtI GCTAGC 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 100
BseBI CCWGG 1 cut(s) 42
BseLI CCNNNNNNNGG 1 cut(s) 16
BseNI ACTGG 1 cut(s) 100
BseXI GCAGC 2 cut(s) 121, 124
BshNI GGYRCC 1 cut(s) 37
BslI CCNNNNNNNGG 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 39
BspMAI CTGCAG 1 cut(s) 142
BspOI GCTAGC 1 cut(s) 134
BspT107I GGYRCC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 42
BstAPI GCANNNNNTGC 1 cut(s) 146
BstC8I GCNNGC 2 cut(s) 6, 132
BstMWI GCNNNNNNNGC 2 cut(s) 108, 146
BstNI CCWGG 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 40
BstSFI CTRYAG 1 cut(s) 138
BstV1I GCAGC 2 cut(s) 121, 124
Cac8I GCNNGC 2 cut(s) 6, 132
CviJI RGCY 3 cut(s) 102, 111, 134
CviKI_1 RGCY 3 cut(s) 102, 111, 134
Eco57I CTGAAG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 40
FaiI YATR 1 cut(s) 17
Fnu4HI GCNGC 2 cut(s) 135, 138
Fsp4HI GCNGC 2 cut(s) 135, 138
FspBI CTAG 1 cut(s) 131
GluI GCNGC 2 cut(s) 135, 138
Hpy188I TCNGA 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 65
HpyCH4V TGCA 2 cut(s) 140, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 146
LpnPI CCDG 6 cut(s) 18, 27, 54, 81, 90, 145
Lsp1109I GCAGC 2 cut(s) 121, 124
MaeI CTAG 1 cut(s) 131
MboII GAAGA 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 2 cut(s) 108, 146
NheI GCTAGC 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 39
PkrI GCNGC 2 cut(s) 136, 139
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 39
PstI CTGCAG 1 cut(s) 142
SatI GCNGC 2 cut(s) 135, 138
ScrFI CCNGG 1 cut(s) 42
SetI ASST 5 cut(s) 76, 104, 113, 136, 164
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 8 cut(s) 17, 53, 54, 108, 117, 136, 143, 158
SspMI CTAG 1 cut(s) 131
StyD4I CCNGG 1 cut(s) 40
TseI GCWGC 2 cut(s) 134, 137
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.