MD01G1122600.v1.1

Belongs to the universal ribosomal protein uS8 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
OG0005993
Physical Location & Seq
Forward (+)
23577664 .. 23579502
1839 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1122600.v1.1.491

Sequence Viewer

Length: 390 bp
ATGAGAGTTAGCGTTCTGAATGATGCTCTTAAGAGCATGTACAATGCTGAGAAAAGGGGCAAGCGCCAGGTCATGATCAGACCATCGTCCAAGGTCATTGTCAAGTTTCTTTTGGTGATGCAAAAGCACGGATACATTGGCGAGTTTGAGTATGTTGATGATCACAGGGCTGGTAAAATTGTGGTCGAGCTGAATGGAAGGCTTAACAAGTGTGGGGTTATCAGCCCTCGTTTTGATGTCGGCGTTAAGGAGATTGAGGGATGGACTGCAAGGTTGCTTCCCTCTAGACAGTTTGGATACATTGTGCTGACAACATCTGCTGGCATTATGGACCACGAGGAGGCTAGAAGAAAGAATGTCGGTGGTAAAGTGCTTGGTTTCTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

130

Amino Acids

14.66

Weight (kDa)

9.89

Isoelectric Point (pI)

32.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 6 - 129 1.5e-21 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 340
AflII CTTAAG 1 cut(s) 29
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 1 cut(s) 190
AluI AGCT 1 cut(s) 190
AspLEI GCGC 1 cut(s) 66
AspS9I GGNCC 1 cut(s) 331
AsuHPI GGTGA 1 cut(s) 127
AvaII GGWCC 1 cut(s) 331
BauI CACGAG 1 cut(s) 335
BccI CCATC 2 cut(s) 91, 255
BciT130I CCWGG 1 cut(s) 68
BciVI GTATCC 2 cut(s) 125, 290
BclI TGATCA 2 cut(s) 75, 160
BfaI CTAG 3 cut(s) 285, 345, 388
BfoI RGCGCY 1 cut(s) 67
BfrI CTTAAG 1 cut(s) 29
BfuI GTATCC 2 cut(s) 125, 290
Bme1390I CCNGG 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 331
BmgT120I GGNCC 1 cut(s) 331
BmrFI CCNGG 1 cut(s) 68
BmsI GCATC 2 cut(s) 13, 108
BoxI GACNNNNGTC 1 cut(s) 85
BsaJI CCNNGG 1 cut(s) 90
Bsc4I CCNNNNNNNGG 1 cut(s) 340
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 340
BseMII CTCAG 1 cut(s) 39
BseRI GAGGAG 1 cut(s) 353
BslI CCNNNNNNNGG 1 cut(s) 340
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 2 cut(s) 75, 160
BspCNI CTCAG 1 cut(s) 40
BspHI TCATGA 1 cut(s) 72
BspTI CTTAAG 1 cut(s) 29
BsrGI TGTACA 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 2 cut(s) 75, 160
BssSI CACGAG 1 cut(s) 335
BssT1I CCWWGG 1 cut(s) 90
Bst2BI CACGAG 1 cut(s) 335
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 291
BstAFI CTTAAG 1 cut(s) 29
BstAUI TGTACA 1 cut(s) 39
BstC8I GCNNGC 2 cut(s) 62, 322
BstDEI CTNAG 1 cut(s) 48
BstF5I GGATG 1 cut(s) 266
BstH2I RGCGCY 1 cut(s) 67
BstHHI GCGC 1 cut(s) 66
BstKTI GATC 2 cut(s) 78, 163
BstMBI GATC 2 cut(s) 75, 160
BstNI CCWGG 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 40
BstPAI GACNNNNGTC 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 66
BsuI GTATCC 2 cut(s) 125, 290
BtsCI GGATG 1 cut(s) 266
Cac8I GCNNGC 2 cut(s) 62, 322
CciI TCATGA 1 cut(s) 72
CfoI GCGC 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 331
Csp6I GTAC 1 cut(s) 40
CviAII CATG 2 cut(s) 37, 73
CviJI RGCY 5 cut(s) 170, 190, 202, 225, 344
CviKI_1 RGCY 5 cut(s) 170, 190, 202, 225, 344
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 1 cut(s) 48
DpnI GATC 2 cut(s) 77, 162
DpnII GATC 2 cut(s) 75, 160
Eco130I CCWWGG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 331
EcoRII CCWGG 1 cut(s) 66
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 2 cut(s) 40, 76
FaiI YATR 4 cut(s) 38, 74, 153, 329
FatI CATG 2 cut(s) 36, 72
FbaI TGATCA 2 cut(s) 75, 160
FokI GGATG 1 cut(s) 273
FspBI CTAG 3 cut(s) 285, 345, 388
GlaI GCGC 1 cut(s) 65
HaeII RGCGCY 1 cut(s) 67
HhaI GCGC 1 cut(s) 66
Hin1II CATG 2 cut(s) 40, 76
Hin6I GCGC 1 cut(s) 64
HinP1I GCGC 1 cut(s) 64
HphI GGTGA 1 cut(s) 127
Hpy188I TCNGA 2 cut(s) 18, 80
Hpy188III TCNNGA 2 cut(s) 73, 285
HpyAV CCTTC 1 cut(s) 192
HpyCH4III ACNGT 1 cut(s) 291
HpyCH4V TGCA 2 cut(s) 121, 269
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 2 cut(s) 40, 76
HspAI GCGC 1 cut(s) 64
Ksp22I TGATCA 2 cut(s) 75, 160
Kzo9I GATC 2 cut(s) 75, 160
LpnPI CCDG 5 cut(s) 53, 80, 151, 156, 306
LweI GCATC 2 cut(s) 13, 108
MaeI CTAG 3 cut(s) 285, 345, 388
MalI GATC 2 cut(s) 77, 162
MboI GATC 2 cut(s) 75, 160
MboII GAAGA 1 cut(s) 360
MluCI AATT 1 cut(s) 177
MnlI CCTC 5 cut(s) 237, 250, 292, 331, 334
MseI TTAA 3 cut(s) 30, 204, 246
MspCI CTTAAG 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
NdeII GATC 2 cut(s) 75, 160
NlaIII CATG 2 cut(s) 40, 76
NspI RCATGY 1 cut(s) 40
PagI TCATGA 1 cut(s) 72
PshAI GACNNNNGTC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
PspPI GGNCC 1 cut(s) 331
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 3 cut(s) 30, 204, 246
Sau3AI GATC 2 cut(s) 75, 160
Sau96I GGNCC 1 cut(s) 331
ScrFI CCNGG 1 cut(s) 68
SetI ASST 4 cut(s) 72, 96, 192, 275
SfaNI GCATC 2 cut(s) 13, 108
SinI GGWCC 1 cut(s) 331
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 1 cut(s) 177
SspMI CTAG 3 cut(s) 285, 345, 388
StyD4I CCNGG 1 cut(s) 66
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 291
TaqI TCGA 1 cut(s) 186
TasI AATT 1 cut(s) 177
TatI WGTACW 1 cut(s) 39
Tru1I TTAA 3 cut(s) 30, 204, 246
Tru9I TTAA 3 cut(s) 30, 204, 246
TspGWI ACGGA 1 cut(s) 144
Vha464I CTTAAG 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 331
XbaI TCTAGA 1 cut(s) 284
XceI RCATGY 1 cut(s) 40
XspI CTAG 3 cut(s) 285, 345, 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.