RchiOBHm_Chr3g0475511

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
21328157 .. 21328768
612 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44101

Sequence Viewer

Length: 330 bp
ATGGTGAGAGTCAGCGTTTTGAATGATGCTCTTAAGAGCATGTACAACGCAGAGAAGAGGGGCAAGAGACAGGTCATTATCAGGCCTTCGTCCAAGGTCATCATCAAGTTCCTTATCGTTATGCAGAAGCACGGTTATATTGGAGAGTTTGAGTATGTTGATGACCACAGATCTGGAAAGATTGTGGTTGAACTCAATGGGAGGCTGAACAAGTGTGGGGTTATCAGTCCTCGCTTTGATGTTGGTGTCAAGGAGATTGAAGGCTGGACGGCTAGACTTCTTCCGTCAAGACAGATGGAACTATTGATTTTGGATTATCTATTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.55

Weight (kDa)

9.67

Isoelectric Point (pI)

35.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 7 - 87 2.6e-11 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 44
AflII CTTAAG 1 cut(s) 32
AgsI TTSAA 3 cut(s) 22, 191, 260
Alw26I GTCTC 1 cut(s) 61
AoxI GGCC 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 16
BccI CCATC 1 cut(s) 289
BceAI ACGGC 1 cut(s) 285
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 273
BfrI CTTAAG 1 cut(s) 32
BglII AGATCT 1 cut(s) 170
BmsI GCATC 1 cut(s) 16
BsaJI CCNNGG 1 cut(s) 93
BseDI CCNNGG 1 cut(s) 93
BshFI GGCC 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 61
BsnI GGCC 1 cut(s) 85
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 1 cut(s) 170
BspANI GGCC 1 cut(s) 85
BspTI CTTAAG 1 cut(s) 32
BsrGI TGTACA 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 1 cut(s) 170
BssT1I CCWWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 134
Bst6I CTCTTC 1 cut(s) 50
BstAFI CTTAAG 1 cut(s) 32
BstAUI TGTACA 1 cut(s) 42
BstKTI GATC 1 cut(s) 173
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 1 cut(s) 170
BstNSI RCATGY 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 170
BstXI CCANNNNNNTGG 1 cut(s) 173
BstYI RGATCY 1 cut(s) 170
BsuRI GGCC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 43
CviAII CATG 1 cut(s) 40
CviJI RGCY 4 cut(s) 85, 205, 264, 272
CviKI_1 RGCY 4 cut(s) 85, 205, 264, 272
CviQI GTAC 1 cut(s) 43
DpnI GATC 1 cut(s) 172
DpnII GATC 1 cut(s) 170
Eam1104I CTCTTC 1 cut(s) 50
EarI CTCTTC 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 93
Eco147I AGGCCT 1 cut(s) 85
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 1 cut(s) 43
FaiI YATR 4 cut(s) 41, 122, 138, 156
FatI CATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 273
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 1 cut(s) 43
HinfI GANTC 1 cut(s) 9
HphI GGTGA 1 cut(s) 16
Hpy188III TCNNGA 3 cut(s) 174, 288, 327
HpyAV CCTTC 2 cut(s) 96, 254
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4V TGCA 1 cut(s) 124
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 1 cut(s) 170
LpnPI CCDG 4 cut(s) 56, 67, 159, 250
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 273
MalI GATC 1 cut(s) 172
MboI GATC 1 cut(s) 170
MboII GAAGA 2 cut(s) 67, 272
MflI RGATCY 1 cut(s) 170
MlyI GAGTC 1 cut(s) 18
MnlI CCTC 3 cut(s) 51, 195, 240
MseI TTAA 1 cut(s) 33
MspCI CTTAAG 1 cut(s) 32
NdeII GATC 1 cut(s) 170
NlaIII CATG 1 cut(s) 43
NspI RCATGY 1 cut(s) 43
PceI AGGCCT 1 cut(s) 85
PleI GAGTC 1 cut(s) 17
PpsI GAGTC 1 cut(s) 17
PsuI RGATCY 1 cut(s) 170
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 1 cut(s) 33
Sau3AI GATC 1 cut(s) 170
SchI GAGTC 1 cut(s) 18
SetI ASST 2 cut(s) 75, 99
SfaNI GCATC 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
SseBI AGGCCT 1 cut(s) 85
SspMI CTAG 1 cut(s) 273
StuI AGGCCT 1 cut(s) 85
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 134
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TspGWI ACGGA 1 cut(s) 273
Vha464I CTTAAG 1 cut(s) 32
XceI RCATGY 1 cut(s) 43
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.