Prupe.2G230100_v2.0.a1

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Forward (+)
25480959 .. 25483142
2184 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G230100.1

Sequence Viewer

Length: 393 bp
ATGGTGAGAGTTAGCGTTCTGAACGATGCGCTCAAGAGCATGTACAATGCAGAGAAAAGGGGCAAGCGCCAGGTCATGATCAGACCATCATCCAAGGTCATCATCAAGTTTCTTTTGGTGATGCAAAAGCATGGATACATTGGTGAGTTCGAGTATGTTGATGACCACAGGGCTGGTAAAATTGTGGTCGAACTGAATGGACGGCTTAACAAATGTGGGGTTATCAGCCCTCGTTTTGATGTGGGTGTTAAGGAGATTGAAGGCTGGACTGCAAGATTGCTTCCATCTAGACAGTTTGGATACATAGTGCTGACAACATCTGCTGGCATTATGGATCATGAGGAGGCTAGGAGAAAGAATGTTGGTGGTAAAGTGCTTGGTTTCTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.77

Weight (kDa)

9.89

Isoelectric Point (pI)

33.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 342
AfaI GTAC 1 cut(s) 44
AgsI TTSAA 1 cut(s) 260
AjnI CCWGG 1 cut(s) 69
AlwI GGATC 1 cut(s) 342
AspLEI GCGC 2 cut(s) 31, 69
AsuHPI GGTGA 3 cut(s) 16, 130, 155
BaeI ACNNNNGTAYC 2 cut(s) 127, 160
BccI CCATC 2 cut(s) 94, 292
BceAI ACGGC 1 cut(s) 218
BciT130I CCWGG 1 cut(s) 71
BciVI GTATCC 2 cut(s) 128, 293
BclI TGATCA 1 cut(s) 78
BfaI CTAG 3 cut(s) 288, 348, 391
BfoI RGCGCY 1 cut(s) 70
BfuI GTATCC 2 cut(s) 128, 293
Bme1390I CCNGG 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 71
BmsI GCATC 2 cut(s) 16, 111
BpuEI CTTGAG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 71
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 89
BseRI GAGGAG 1 cut(s) 356
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 2 cut(s) 78, 334
BspHI TCATGA 2 cut(s) 75, 337
BspPI GGATC 1 cut(s) 342
BsrGI TGTACA 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 2 cut(s) 78, 334
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 71
Bst4CI ACNGT 1 cut(s) 294
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 65, 325
BstF5I GGATG 1 cut(s) 89
BstH2I RGCGCY 1 cut(s) 70
BstHHI GCGC 2 cut(s) 31, 69
BstKTI GATC 2 cut(s) 81, 337
BstMBI GATC 2 cut(s) 78, 334
BstNI CCWGG 1 cut(s) 71
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 69
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 2 cut(s) 128, 293
BtsCI GGATG 1 cut(s) 89
Cac8I GCNNGC 2 cut(s) 65, 325
CciI TCATGA 2 cut(s) 75, 337
CfoI GCGC 2 cut(s) 31, 69
Csp6I GTAC 1 cut(s) 43
CviAII CATG 4 cut(s) 40, 76, 131, 338
CviJI RGCY 5 cut(s) 173, 205, 228, 264, 347
CviKI_1 RGCY 5 cut(s) 173, 205, 228, 264, 347
CviQI GTAC 1 cut(s) 43
DpnI GATC 2 cut(s) 80, 336
DpnII GATC 2 cut(s) 78, 334
Eco130I CCWWGG 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FaeI CATG 4 cut(s) 43, 79, 134, 341
FaiI YATR 7 cut(s) 41, 77, 132, 156, 305, 332, 339
FatI CATG 4 cut(s) 39, 75, 130, 337
FbaI TGATCA 1 cut(s) 78
FokI GGATG 1 cut(s) 76
FspBI CTAG 3 cut(s) 288, 348, 391
GlaI GCGC 2 cut(s) 30, 68
HaeII RGCGCY 1 cut(s) 70
HhaI GCGC 2 cut(s) 31, 69
Hin1II CATG 4 cut(s) 43, 79, 134, 341
Hin6I GCGC 2 cut(s) 29, 67
HinP1I GCGC 2 cut(s) 29, 67
HphI GGTGA 3 cut(s) 16, 130, 155
Hpy188I TCNGA 2 cut(s) 21, 83
Hpy188III TCNNGA 4 cut(s) 34, 76, 288, 338
HpyAV CCTTC 1 cut(s) 254
HpyCH4III ACNGT 1 cut(s) 294
HpyCH4V TGCA 3 cut(s) 50, 124, 272
Hsp92II CATG 4 cut(s) 43, 79, 134, 341
HspAI GCGC 2 cut(s) 29, 67
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 2 cut(s) 78, 334
LpnPI CCDG 6 cut(s) 56, 83, 154, 159, 250, 309
LweI GCATC 2 cut(s) 16, 111
MaeI CTAG 3 cut(s) 288, 348, 391
MalI GATC 2 cut(s) 80, 336
MboI GATC 2 cut(s) 78, 334
MluCI AATT 1 cut(s) 180
MnlI CCTC 3 cut(s) 240, 334, 337
MseI TTAA 2 cut(s) 207, 249
MspR9I CCNGG 1 cut(s) 71
MvaI CCWGG 1 cut(s) 71
NdeII GATC 2 cut(s) 78, 334
NlaIII CATG 4 cut(s) 43, 79, 134, 341
NspI RCATGY 1 cut(s) 43
PagI TCATGA 2 cut(s) 75, 337
Psp6I CCWGG 1 cut(s) 69
PspGI CCWGG 1 cut(s) 69
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 207, 249
Sau3AI GATC 2 cut(s) 78, 334
ScrFI CCNGG 1 cut(s) 71
SetI ASST 2 cut(s) 75, 99
SfaNI GCATC 2 cut(s) 16, 111
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 180
SspMI CTAG 3 cut(s) 288, 348, 391
StyD4I CCNGG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 294
TaqI TCGA 2 cut(s) 150, 189
TasI AATT 1 cut(s) 180
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 2 cut(s) 207, 249
Tru9I TTAA 2 cut(s) 207, 249
XbaI TCTAGA 1 cut(s) 287
XceI RCATGY 1 cut(s) 43
XspI CTAG 3 cut(s) 288, 348, 391
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.