MD07G1192100.v1.1

Belongs to the universal ribosomal protein uS8 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0005993
Physical Location & Seq
Forward (+)
27188424 .. 27190380
1957 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1192100.v1.1.491

Sequence Viewer

Length: 354 bp
ATGTACAATGCTGAGAAAAGGGGCAAGCGCCAGGTCATGATCAGACCATCATCCAAGGTCATCATCAAGTTTCTTTTGGTGATGCAAAAGCATGGATACATTGGTGAGTTTGAGTATGTTGATGATCACAGGGCTGGTAAAATTGTGGTCGAGCTGAATGGAAGGCTTAACAAGTGTGGGGTTATTAGCCCTCGTTTTGATGTTGGTGTTAAGGAGATTGAAGGATGGACTGCCAGGTTGCTTCCTTCTAGACAGTTTGGATACATTGTGCTGACAACATCTGCTGGCATTATGGACCATGAGGAGGCTAGGAGAAAGAATGTCGGTGGTAAAGTGCTTGGTTTCTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

118

Amino Acids

13.36

Weight (kDa)

9.83

Isoelectric Point (pI)

36.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 2 - 117 2.4e-19 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 304
AgsI TTSAA 1 cut(s) 221
AjnI CCWGG 2 cut(s) 30, 233
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AspLEI GCGC 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 295
AsuHPI GGTGA 2 cut(s) 91, 116
AvaII GGWCC 1 cut(s) 295
BaeI ACNNNNGTAYC 2 cut(s) 88, 121
BccI CCATC 2 cut(s) 55, 219
BciT130I CCWGG 2 cut(s) 32, 235
BciVI GTATCC 2 cut(s) 89, 254
BclI TGATCA 2 cut(s) 39, 124
BfaI CTAG 3 cut(s) 249, 309, 352
BfoI RGCGCY 1 cut(s) 31
BfuI GTATCC 2 cut(s) 89, 254
Bme1390I CCNGG 2 cut(s) 32, 235
Bme18I GGWCC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 295
BmrFI CCNGG 2 cut(s) 32, 235
BmsI GCATC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 304
BseBI CCWGG 2 cut(s) 32, 235
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 50, 230
BseLI CCNNNNNNNGG 1 cut(s) 304
BseRI GAGGAG 1 cut(s) 317
BslI CCNNNNNNNGG 1 cut(s) 304
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 2 cut(s) 39, 124
BspCNI CTCAG 1 cut(s) 4
BspHI TCATGA 1 cut(s) 36
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 2 cut(s) 39, 124
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 2 cut(s) 32, 235
Bst4CI ACNGT 1 cut(s) 255
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 2 cut(s) 26, 286
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 50, 230
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 2 cut(s) 42, 127
BstMBI GATC 2 cut(s) 39, 124
BstNI CCWGG 2 cut(s) 32, 235
BstSCI CCNGG 2 cut(s) 30, 233
BsuI GTATCC 2 cut(s) 89, 254
BtsCI GGATG 2 cut(s) 50, 230
Cac8I GCNNGC 2 cut(s) 26, 286
CciI TCATGA 1 cut(s) 36
CfoI GCGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 295
Csp6I GTAC 1 cut(s) 4
CviAII CATG 3 cut(s) 37, 92, 299
CviJI RGCY 5 cut(s) 134, 154, 166, 189, 308
CviKI_1 RGCY 5 cut(s) 134, 154, 166, 189, 308
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 12
DpnI GATC 2 cut(s) 41, 126
DpnII GATC 2 cut(s) 39, 124
Eco130I CCWWGG 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 295
EcoRII CCWGG 2 cut(s) 30, 233
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 3 cut(s) 40, 95, 302
FaiI YATR 5 cut(s) 38, 93, 117, 293, 300
FatI CATG 3 cut(s) 36, 91, 298
FbaI TGATCA 2 cut(s) 39, 124
FokI GGATG 2 cut(s) 37, 237
FspBI CTAG 3 cut(s) 249, 309, 352
GlaI GCGC 1 cut(s) 29
HaeII RGCGCY 1 cut(s) 31
HhaI GCGC 1 cut(s) 30
Hin1II CATG 3 cut(s) 40, 95, 302
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HphI GGTGA 2 cut(s) 91, 116
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 37, 249
HpyAV CCTTC 3 cut(s) 156, 215, 255
HpyCH4III ACNGT 1 cut(s) 255
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 3 cut(s) 40, 95, 302
HspAI GCGC 1 cut(s) 28
Ksp22I TGATCA 2 cut(s) 39, 124
Kzo9I GATC 2 cut(s) 39, 124
LpnPI CCDG 7 cut(s) 17, 44, 115, 120, 220, 247, 270
LweI GCATC 1 cut(s) 72
MaeI CTAG 3 cut(s) 249, 309, 352
MalI GATC 2 cut(s) 41, 126
MboI GATC 2 cut(s) 39, 124
MluCI AATT 1 cut(s) 141
MnlI CCTC 3 cut(s) 201, 295, 298
MseI TTAA 2 cut(s) 168, 210
MspR9I CCNGG 2 cut(s) 32, 235
MvaI CCWGG 2 cut(s) 32, 235
NdeII GATC 2 cut(s) 39, 124
NlaIII CATG 3 cut(s) 40, 95, 302
PagI TCATGA 1 cut(s) 36
Psp6I CCWGG 2 cut(s) 30, 233
PspGI CCWGG 2 cut(s) 30, 233
PspPI GGNCC 1 cut(s) 295
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 168, 210
Sau3AI GATC 2 cut(s) 39, 124
Sau96I GGNCC 1 cut(s) 295
ScrFI CCNGG 2 cut(s) 32, 235
SetI ASST 4 cut(s) 36, 60, 156, 239
SfaNI GCATC 1 cut(s) 72
SinI GGWCC 1 cut(s) 295
Sse9I AATT 1 cut(s) 141
SspMI CTAG 3 cut(s) 249, 309, 352
StyD4I CCNGG 2 cut(s) 30, 233
StyI CCWWGG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 255
TaqI TCGA 1 cut(s) 150
TasI AATT 1 cut(s) 141
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 168, 210
Tru9I TTAA 2 cut(s) 168, 210
VpaK11BI GGWCC 1 cut(s) 295
XbaI TCTAGA 1 cut(s) 248
XspI CTAG 3 cut(s) 249, 309, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.