Prupe.6G083600_v2.0.a1

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
5645765 .. 5647070
1306 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G083600.2

Sequence Viewer

Length: 393 bp
ATGGTGCGCGTCAGCGTTTTGAACGACGCTCTGAAGAGCATGTACAACGCCGAGAAGAGGGGGAAGCGACAAGTCATGATCAGGCCATCATCGAAGGTCATCATCAAGTTCCTTTTGGTTATGCAAAAGCACGGTTATATTGGCGAGTTTGAGTATGTTGATGACCACAGAGCTGGAAAGATTGTGGTTGAACTCAATGGGAGGCTGAACAAGTGTGGTGTTATCAGTCCTCGATTCGATGTCGGTGTTAAGGAGATCGAAGGCTGGACTGCTAGGCTTCTGCCTTCTAGACAGTTTGGATACATTGTGCTGACAACATCTGCTGGTATCATGGATCATGAAGAAGCTAGGAGAAAGAATGTTGGTGGCAAAGTCCTTGGTTTCTTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

14.77

Weight (kDa)

9.89

Isoelectric Point (pI)

33.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 9
AclWI GGATC 1 cut(s) 342
AcuI CTGAAG 1 cut(s) 53
AfaI GTAC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 57
AgsI TTSAA 2 cut(s) 22, 191
AluBI AGCT 2 cut(s) 173, 347
AluI AGCT 2 cut(s) 173, 347
AlwI GGATC 1 cut(s) 342
AoxI GGCC 1 cut(s) 83
AspLEI GCGC 1 cut(s) 9
BarI GAAGNNNNNNTAC 2 cut(s) 26, 58
BccI CCATC 1 cut(s) 94
BciVI GTATCC 1 cut(s) 293
BclI TGATCA 1 cut(s) 78
BfaI CTAG 3 cut(s) 273, 288, 348
BfuI GTATCC 1 cut(s) 293
BsaJI CCNNGG 1 cut(s) 376
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 376
BseLI CCNNNNNNNGG 1 cut(s) 57
Bsh1236I CGCG 1 cut(s) 9
BshFI GGCC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 57
BsnI GGCC 1 cut(s) 85
Bsp1407I TGTACA 1 cut(s) 42
Bsp143I GATC 3 cut(s) 78, 255, 334
BspANI GGCC 1 cut(s) 85
BspFNI CGCG 1 cut(s) 9
BspHI TCATGA 2 cut(s) 75, 337
BspPI GGATC 1 cut(s) 342
BspQI GCTCTTC 1 cut(s) 29
BsrGI TGTACA 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 376
BssMI GATC 3 cut(s) 78, 255, 334
BssT1I CCWWGG 1 cut(s) 376
Bst4CI ACNGT 2 cut(s) 134, 294
Bst6I CTCTTC 2 cut(s) 29, 50
BstAUI TGTACA 1 cut(s) 42
BstFNI CGCG 1 cut(s) 9
BstHHI GCGC 1 cut(s) 9
BstKTI GATC 3 cut(s) 81, 258, 337
BstMBI GATC 3 cut(s) 78, 255, 334
BstNSI RCATGY 1 cut(s) 43
BstUI CGCG 1 cut(s) 9
BstXI CCANNNNNNTGG 1 cut(s) 173
BsuI GTATCC 1 cut(s) 293
BsuRI GGCC 1 cut(s) 85
CciI TCATGA 2 cut(s) 75, 337
CfoI GCGC 1 cut(s) 9
CseI GACGC 1 cut(s) 35
Csp6I GTAC 1 cut(s) 43
CviAII CATG 4 cut(s) 40, 76, 331, 338
CviJI RGCY 6 cut(s) 85, 173, 205, 264, 277, 347
CviKI_1 RGCY 6 cut(s) 85, 173, 205, 264, 277, 347
CviQI GTAC 1 cut(s) 43
DpnI GATC 3 cut(s) 80, 257, 336
DpnII GATC 3 cut(s) 78, 255, 334
Eam1104I CTCTTC 2 cut(s) 29, 50
EarI CTCTTC 2 cut(s) 29, 50
Eco130I CCWWGG 1 cut(s) 376
Eco57I CTGAAG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 376
ErhI CCWWGG 1 cut(s) 376
FaeI CATG 4 cut(s) 43, 79, 334, 341
FaiI YATR 7 cut(s) 41, 77, 122, 138, 156, 332, 339
FatI CATG 4 cut(s) 39, 75, 330, 337
FbaI TGATCA 1 cut(s) 78
FspBI CTAG 3 cut(s) 273, 288, 348
GlaI GCGC 1 cut(s) 8
HaeIII GGCC 1 cut(s) 85
HgaI GACGC 1 cut(s) 35
HhaI GCGC 1 cut(s) 9
Hin1II CATG 4 cut(s) 43, 79, 334, 341
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HinfI GANTC 1 cut(s) 234
Hpy188I TCNGA 1 cut(s) 33
Hpy188III TCNNGA 3 cut(s) 76, 288, 338
Hpy99I CGWCG 1 cut(s) 29
HpyAV CCTTC 3 cut(s) 88, 254, 294
HpyCH4III ACNGT 2 cut(s) 134, 294
HpyCH4V TGCA 1 cut(s) 124
Hsp92II CATG 4 cut(s) 43, 79, 334, 341
HspAI GCGC 1 cut(s) 7
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 3 cut(s) 78, 255, 334
LguI GCTCTTC 1 cut(s) 29
LpnPI CCDG 4 cut(s) 67, 159, 250, 309
MaeI CTAG 3 cut(s) 273, 288, 348
MalI GATC 3 cut(s) 80, 257, 336
MboI GATC 3 cut(s) 78, 255, 334
MboII GAAGA 3 cut(s) 46, 67, 353
MnlI CCTC 3 cut(s) 51, 195, 240
MseI TTAA 1 cut(s) 249
MvnI CGCG 1 cut(s) 9
NdeII GATC 3 cut(s) 78, 255, 334
NlaIII CATG 4 cut(s) 43, 79, 334, 341
NmeAIII GCCGAG 1 cut(s) 76
NspI RCATGY 1 cut(s) 43
PagI TCATGA 2 cut(s) 75, 337
PciSI GCTCTTC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 234
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SapI GCTCTTC 1 cut(s) 29
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 3 cut(s) 78, 255, 334
SetI ASST 3 cut(s) 99, 175, 349
SspMI CTAG 3 cut(s) 273, 288, 348
StyI CCWWGG 1 cut(s) 376
TaaI ACNGT 2 cut(s) 134, 294
TaqI TCGA 4 cut(s) 92, 232, 237, 258
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 234
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TspDTI ATGAA 1 cut(s) 354
XbaI TCTAGA 1 cut(s) 287
XceI RCATGY 1 cut(s) 43
XspI CTAG 3 cut(s) 273, 288, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.