pycom07g18150

Belongs to the universal ribosomal protein uS8 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0005993
Physical Location & Seq
Forward (+)
20648488 .. 20649317
830 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g18150.1

Sequence Viewer

Length: 351 bp
ATGTACAATGCTGAGAAAAGGGGCAAGCGCCAGGTCATGATCAGACCATCATCCAAGGTCATCATCAAGTTTCTTTTGGTGATGCAAAAGCATGGTACTGGTGAGTTCGAGTATGTTGATGATCACAGGGCTGGTAAAATTGTGGTCGAGCTGAATGGAAGGCTTAACAAGTGTGGGGTTATTAGCCCTCGTTTTGATGTTGGTGTTAAGGAGATCGAAGGATGGACTGCCAGGTTGCTTCCTTCTAGACAGTTTGGATACATTGTGCTGACAACATCTGCTGGCATTATGGACCATGAGGAGGCTAGGAGAAAGAATGTCGGTGGTAAAGTGCTTGGTTTCTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

117

Amino Acids

13.19

Weight (kDa)

9.88

Isoelectric Point (pI)

35.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 2 - 116 5.7e-15 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 5, 97
AfiI CCNNNNNNNGG 1 cut(s) 301
AjnI CCWGG 2 cut(s) 30, 230
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
AspLEI GCGC 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 292
AsuHPI GGTGA 2 cut(s) 91, 113
AvaII GGWCC 1 cut(s) 292
BccI CCATC 2 cut(s) 55, 216
BciT130I CCWGG 2 cut(s) 32, 232
BciVI GTATCC 1 cut(s) 251
BclI TGATCA 2 cut(s) 39, 121
BfaI CTAG 3 cut(s) 246, 306, 349
BfoI RGCGCY 1 cut(s) 31
BfuI GTATCC 1 cut(s) 251
Bme1390I CCNGG 2 cut(s) 32, 232
Bme18I GGWCC 1 cut(s) 292
BmgT120I GGNCC 1 cut(s) 292
BmrFI CCNGG 2 cut(s) 32, 232
BmsI GCATC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 301
Bse1I ACTGG 1 cut(s) 103
BseBI CCWGG 2 cut(s) 32, 232
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 50, 227
BseLI CCNNNNNNNGG 1 cut(s) 301
BseNI ACTGG 1 cut(s) 103
BseRI GAGGAG 1 cut(s) 314
BslI CCNNNNNNNGG 1 cut(s) 301
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 3 cut(s) 39, 121, 213
BspCNI CTCAG 1 cut(s) 4
BspHI TCATGA 1 cut(s) 36
BsrGI TGTACA 1 cut(s) 3
BsrI ACTGG 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 3 cut(s) 39, 121, 213
BssT1I CCWWGG 1 cut(s) 54
Bst2UI CCWGG 2 cut(s) 32, 232
Bst4CI ACNGT 1 cut(s) 252
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 2 cut(s) 26, 283
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 50, 227
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 3 cut(s) 42, 124, 216
BstMBI GATC 3 cut(s) 39, 121, 213
BstNI CCWGG 2 cut(s) 32, 232
BstSCI CCNGG 2 cut(s) 30, 230
BsuI GTATCC 1 cut(s) 251
BtsCI GGATG 2 cut(s) 50, 227
Cac8I GCNNGC 2 cut(s) 26, 283
CciI TCATGA 1 cut(s) 36
CfoI GCGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 292
Csp6I GTAC 2 cut(s) 4, 96
CviAII CATG 3 cut(s) 37, 92, 296
CviJI RGCY 5 cut(s) 131, 151, 163, 186, 305
CviKI_1 RGCY 5 cut(s) 131, 151, 163, 186, 305
CviQI GTAC 2 cut(s) 4, 96
DdeI CTNAG 1 cut(s) 12
DpnI GATC 3 cut(s) 41, 123, 215
DpnII GATC 3 cut(s) 39, 121, 213
Eco130I CCWWGG 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 292
EcoRII CCWGG 2 cut(s) 30, 230
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 3 cut(s) 40, 95, 299
FaiI YATR 5 cut(s) 38, 93, 114, 290, 297
FatI CATG 3 cut(s) 36, 91, 295
FbaI TGATCA 2 cut(s) 39, 121
FokI GGATG 2 cut(s) 37, 234
FspBI CTAG 3 cut(s) 246, 306, 349
GlaI GCGC 1 cut(s) 29
HaeII RGCGCY 1 cut(s) 31
HhaI GCGC 1 cut(s) 30
Hin1II CATG 3 cut(s) 40, 95, 299
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HphI GGTGA 2 cut(s) 91, 113
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 37, 246
HpyAV CCTTC 3 cut(s) 153, 212, 252
HpyCH4III ACNGT 1 cut(s) 252
HpyCH4V TGCA 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 3 cut(s) 40, 95, 299
HspAI GCGC 1 cut(s) 28
Ksp22I TGATCA 2 cut(s) 39, 121
Kzo9I GATC 3 cut(s) 39, 121, 213
LpnPI CCDG 8 cut(s) 17, 44, 84, 112, 117, 217, 244, 267
LweI GCATC 1 cut(s) 72
MaeI CTAG 3 cut(s) 246, 306, 349
MalI GATC 3 cut(s) 41, 123, 215
MboI GATC 3 cut(s) 39, 121, 213
MluCI AATT 1 cut(s) 138
MnlI CCTC 3 cut(s) 198, 292, 295
MseI TTAA 2 cut(s) 165, 207
MspR9I CCNGG 2 cut(s) 32, 232
MvaI CCWGG 2 cut(s) 32, 232
NdeII GATC 3 cut(s) 39, 121, 213
NlaIII CATG 3 cut(s) 40, 95, 299
PagI TCATGA 1 cut(s) 36
Psp6I CCWGG 2 cut(s) 30, 230
PspGI CCWGG 2 cut(s) 30, 230
PspPI GGNCC 1 cut(s) 292
RsaI GTAC 2 cut(s) 5, 97
RsaNI GTAC 2 cut(s) 4, 96
SaqAI TTAA 2 cut(s) 165, 207
Sau3AI GATC 3 cut(s) 39, 121, 213
Sau96I GGNCC 1 cut(s) 292
ScrFI CCNGG 2 cut(s) 32, 232
SetI ASST 4 cut(s) 36, 60, 153, 236
SfaNI GCATC 1 cut(s) 72
SinI GGWCC 1 cut(s) 292
Sse9I AATT 1 cut(s) 138
SspMI CTAG 3 cut(s) 246, 306, 349
StyD4I CCNGG 2 cut(s) 30, 230
StyI CCWWGG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 252
TaqI TCGA 3 cut(s) 108, 147, 216
TasI AATT 1 cut(s) 138
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 165, 207
Tru9I TTAA 2 cut(s) 165, 207
VpaK11BI GGWCC 1 cut(s) 292
XbaI TCTAGA 1 cut(s) 245
XspI CTAG 3 cut(s) 246, 306, 349
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.