pycom01g14950

Belongs to the universal ribosomal protein uS8 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0005993
Physical Location & Seq
Forward (+)
14989137 .. 14989962
826 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g14950.2

Sequence Viewer

Length: 354 bp
ATGTACAATGCTGAGAAAAGGGGCAAGCGCCAGGTCATGATCAGACCATCATCCAAGGTCATCGTCAAGTTTCTTTTGGTGATGCAAAAGCATGGATACATTGGCGAGTTTGAGTATGTTGATGATCACAGGGCTGGTAAAATTGTGGTCGAGCTGAATGGAAGGCTTAACAAGTGTGGGGTTATCAGCCCTCGTTTTGATGTTGGCGTTAAGGAGATTGAGGGATGGACTGCAAGGTTGCTTCCCTCTAGACAGTTTGGATACATTGTGCTGACAACATCTGCTGGCATTATGGACCACGAGGAGGCTAGAAGAAAGAATGTCGGTGGTAAAGTGCTTGGTTTCTTTTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_S8

Protein Analysis

118

Amino Acids

13.35

Weight (kDa)

9.83

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 304
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AspLEI GCGC 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 295
AsuHPI GGTGA 1 cut(s) 91
AvaII GGWCC 1 cut(s) 295
BauI CACGAG 1 cut(s) 299
BccI CCATC 2 cut(s) 55, 219
BciT130I CCWGG 1 cut(s) 32
BciVI GTATCC 2 cut(s) 89, 254
BclI TGATCA 2 cut(s) 39, 124
BfaI CTAG 3 cut(s) 249, 309, 352
BfoI RGCGCY 1 cut(s) 31
BfuI GTATCC 2 cut(s) 89, 254
Bme1390I CCNGG 1 cut(s) 32
Bme18I GGWCC 1 cut(s) 295
BmgT120I GGNCC 1 cut(s) 295
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 304
BseBI CCWGG 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 50, 230
BseLI CCNNNNNNNGG 1 cut(s) 304
BseRI GAGGAG 1 cut(s) 317
BslI CCNNNNNNNGG 1 cut(s) 304
Bsp1407I TGTACA 1 cut(s) 3
Bsp143I GATC 2 cut(s) 39, 124
BspCNI CTCAG 1 cut(s) 4
BspHI TCATGA 1 cut(s) 36
BsrGI TGTACA 1 cut(s) 3
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 2 cut(s) 39, 124
BssSI CACGAG 1 cut(s) 299
BssT1I CCWWGG 1 cut(s) 54
Bst2BI CACGAG 1 cut(s) 299
Bst2UI CCWGG 1 cut(s) 32
Bst4CI ACNGT 1 cut(s) 255
BstAUI TGTACA 1 cut(s) 3
BstC8I GCNNGC 2 cut(s) 26, 286
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 50, 230
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 2 cut(s) 42, 127
BstMBI GATC 2 cut(s) 39, 124
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BsuI GTATCC 2 cut(s) 89, 254
BtsCI GGATG 2 cut(s) 50, 230
Cac8I GCNNGC 2 cut(s) 26, 286
CciI TCATGA 1 cut(s) 36
CfoI GCGC 1 cut(s) 30
Cfr13I GGNCC 1 cut(s) 295
Csp6I GTAC 1 cut(s) 4
CviAII CATG 2 cut(s) 37, 92
CviJI RGCY 5 cut(s) 134, 154, 166, 189, 308
CviKI_1 RGCY 5 cut(s) 134, 154, 166, 189, 308
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 12
DpnI GATC 2 cut(s) 41, 126
DpnII GATC 2 cut(s) 39, 124
Eco130I CCWWGG 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 295
EcoRII CCWGG 1 cut(s) 30
EcoT14I CCWWGG 1 cut(s) 54
ErhI CCWWGG 1 cut(s) 54
FaeI CATG 2 cut(s) 40, 95
FaiI YATR 4 cut(s) 38, 93, 117, 293
FatI CATG 2 cut(s) 36, 91
FbaI TGATCA 2 cut(s) 39, 124
FokI GGATG 2 cut(s) 37, 237
FspBI CTAG 3 cut(s) 249, 309, 352
GlaI GCGC 1 cut(s) 29
HaeII RGCGCY 1 cut(s) 31
HhaI GCGC 1 cut(s) 30
Hin1II CATG 2 cut(s) 40, 95
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HphI GGTGA 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 37, 249
HpyAV CCTTC 1 cut(s) 156
HpyCH4III ACNGT 1 cut(s) 255
HpyCH4V TGCA 2 cut(s) 85, 233
HpyF3I CTNAG 1 cut(s) 12
Hsp92II CATG 2 cut(s) 40, 95
HspAI GCGC 1 cut(s) 28
Ksp22I TGATCA 2 cut(s) 39, 124
Kzo9I GATC 2 cut(s) 39, 124
LpnPI CCDG 5 cut(s) 17, 44, 115, 120, 270
LweI GCATC 1 cut(s) 72
MaeI CTAG 3 cut(s) 249, 309, 352
MalI GATC 2 cut(s) 41, 126
MboI GATC 2 cut(s) 39, 124
MboII GAAGA 1 cut(s) 324
MluCI AATT 1 cut(s) 141
MnlI CCTC 5 cut(s) 201, 214, 256, 295, 298
MseI TTAA 2 cut(s) 168, 210
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NdeII GATC 2 cut(s) 39, 124
NlaIII CATG 2 cut(s) 40, 95
PagI TCATGA 1 cut(s) 36
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 1 cut(s) 295
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 168, 210
Sau3AI GATC 2 cut(s) 39, 124
Sau96I GGNCC 1 cut(s) 295
ScrFI CCNGG 1 cut(s) 32
SetI ASST 4 cut(s) 36, 60, 156, 239
SfaNI GCATC 1 cut(s) 72
SinI GGWCC 1 cut(s) 295
Sse9I AATT 1 cut(s) 141
SspMI CTAG 3 cut(s) 249, 309, 352
StyD4I CCNGG 1 cut(s) 30
StyI CCWWGG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 255
TaqI TCGA 1 cut(s) 150
TasI AATT 1 cut(s) 141
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 168, 210
Tru9I TTAA 2 cut(s) 168, 210
VpaK11BI GGWCC 1 cut(s) 295
XbaI TCTAGA 1 cut(s) 248
XspI CTAG 3 cut(s) 249, 309, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.