Rmu_sc0004288.1_g000015

Belongs to the universal ribosomal protein uS8 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004288.1
Physical Location & Seq
Reverse (-)
72099 .. 72671
573 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004288.1_g000015.1.cds

Sequence Viewer

Length: 201 bp
ctgaatggaaggcttaacaagtgtggggtcattagtcctcgttttgatgttggtgtgaaggagattgaaggttggactgccaggttacttccttcaagacagtttggatatatcgtgctcaccacttctgctggcatcatggaccatgaagaggctagaagaaagaatgtcggtgggaaagttcttggtttcttttattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.37

Weight (kDa)

9.74

Isoelectric Point (pI)

49.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 151
AgsI TTSAA 2 cut(s) 68, 96
AjnI CCWGG 1 cut(s) 80
Alw21I GWGCWC 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 112
AvaII GGWCC 1 cut(s) 142
Bbv12I GWGCWC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 82
BfaI CTAG 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 82
BmsI GCATC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 151
BseBI CCWGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 151
BsiHKAI GWGCWC 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 151
Bsp1286I GDGCHC 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 102
Bst6I CTCTTC 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 133
BstNI CCWGG 1 cut(s) 82
BstSCI CCNGG 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 133
Cfr13I GGNCC 1 cut(s) 142
CviAII CATG 2 cut(s) 139, 146
CviJI RGCY 2 cut(s) 13, 155
CviKI_1 RGCY 2 cut(s) 13, 155
Eam1104I CTCTTC 1 cut(s) 144
EarI CTCTTC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 80
FaeI CATG 2 cut(s) 142, 149
FaiI YATR 3 cut(s) 111, 140, 147
FatI CATG 2 cut(s) 138, 145
FspBI CTAG 1 cut(s) 156
Hin1II CATG 2 cut(s) 142, 149
HphI GGTGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 96
HpyAV CCTTC 4 cut(s) 3, 52, 62, 102
HpyCH4III ACNGT 1 cut(s) 102
Hsp92II CATG 2 cut(s) 142, 149
LpnPI CCDG 3 cut(s) 67, 94, 117
LweI GCATC 1 cut(s) 144
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 84
MboII GAAGA 2 cut(s) 161, 171
MhlI GDGCHC 1 cut(s) 120
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 2 cut(s) 48, 145
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 82
MvaI CCWGG 1 cut(s) 82
NlaIII CATG 2 cut(s) 142, 149
Psp6I CCWGG 1 cut(s) 80
PspGI CCWGG 1 cut(s) 80
PspPI GGNCC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 82
SduI GDGCHC 1 cut(s) 120
SetI ASST 2 cut(s) 73, 86
SfaNI GCATC 1 cut(s) 144
SinI GGWCC 1 cut(s) 142
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 102
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 142
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.