MD03G1080500.v1.1

Pentatricopeptide repeat-containing protein At5g67570

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Reverse (-)
6505770 .. 6508622
2853 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1080500.v1.1.491

Sequence Viewer

Length: 192 bp
ATGGAAGCTCTGCAAGCTTCCCTCCCACAAGTCCCTCACATCCAATTCGAACCCGACAGTGATAAAATCAAACGCAACCTCACCAAGAAAGGTGTCCACCCAACTCGCAAGATCGTCCACACCGTCCGTAAAAAAGAAATCCAAAAACACAACCGCAAGCTCAACCGCCTCACGGAGGCGGATCCATCTTAG

Protein Analysis

64

Amino Acids

7.33

Weight (kDa)

10.28

Isoelectric Point (pI)

41.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 154, 166, 179
AclWI GGATC 2 cut(s) 176, 189
AfiI CCNNNNNNNGG 2 cut(s) 172, 175
AluBI AGCT 3 cut(s) 8, 17, 160
AluI AGCT 3 cut(s) 8, 17, 160
AlwI GGATC 2 cut(s) 176, 189
AsuHPI GGTGA 1 cut(s) 73
AsuII TTCGAA 1 cut(s) 48
BamHI GGATCC 1 cut(s) 181
BmiI GGNNCC 1 cut(s) 183
Bpu14I TTCGAA 1 cut(s) 48
Bsc4I CCNNNNNNNGG 2 cut(s) 172, 175
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 172, 175
BslFI GGGAC 1 cut(s) 17
BslI CCNNNNNNNGG 2 cut(s) 172, 175
BsmFI GGGAC 1 cut(s) 17
Bsp119I TTCGAA 1 cut(s) 48
Bsp143I GATC 2 cut(s) 111, 181
BspACI CCGC 3 cut(s) 154, 166, 179
BspLI GGNNCC 1 cut(s) 183
BspPI GGATC 2 cut(s) 176, 189
BspT104I TTCGAA 1 cut(s) 48
BssMI GATC 2 cut(s) 111, 181
Bst4CI ACNGT 2 cut(s) 59, 124
BstBI TTCGAA 1 cut(s) 48
BstC8I GCNNGC 2 cut(s) 15, 158
BstDEI CTNAG 1 cut(s) 189
BstENI CCTNNNNNAGG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 39
BstKTI GATC 2 cut(s) 114, 184
BstMBI GATC 2 cut(s) 111, 181
BstMWI GCNNNNNNNGC 1 cut(s) 14
BstX2I RGATCY 1 cut(s) 181
BstYI RGATCY 1 cut(s) 181
BtsCI GGATG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 64
Cac8I GCNNGC 2 cut(s) 15, 158
CviJI RGCY 3 cut(s) 8, 17, 160
CviKI_1 RGCY 3 cut(s) 8, 17, 160
DdeI CTNAG 1 cut(s) 189
DpnI GATC 2 cut(s) 113, 183
DpnII GATC 2 cut(s) 111, 181
EcoNI CCTNNNNNAGG 1 cut(s) 173
FaqI GGGAC 1 cut(s) 17
FokI GGATG 1 cut(s) 26
HindIII AAGCTT 1 cut(s) 15
HphI GGTGA 1 cut(s) 73
Hpy166II GTNNAC 2 cut(s) 97, 118
Hpy8I GTNNAC 2 cut(s) 97, 118
HpyCH4III ACNGT 2 cut(s) 59, 124
HpyCH4V TGCA 1 cut(s) 13
HpyF10VI GCNNNNNNNGC 1 cut(s) 14
HpyF3I CTNAG 1 cut(s) 189
Kzo9I GATC 2 cut(s) 111, 181
MalI GATC 2 cut(s) 113, 183
MboI GATC 2 cut(s) 111, 181
MflI RGATCY 1 cut(s) 181
MluCI AATT 1 cut(s) 44
MnlI CCTC 5 cut(s) 32, 45, 89, 169, 179
MwoI GCNNNNNNNGC 1 cut(s) 14
NdeII GATC 2 cut(s) 111, 181
NlaIV GGNNCC 1 cut(s) 183
NspV TTCGAA 1 cut(s) 48
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 183
PsuI RGATCY 1 cut(s) 181
Sau3AI GATC 2 cut(s) 111, 181
SetI ASST 5 cut(s) 10, 19, 81, 94, 162
SfuI TTCGAA 1 cut(s) 48
SgeI CNNG 8 cut(s) 26, 41, 65, 97, 117, 121, 169, 184
Sse9I AATT 1 cut(s) 44
SsiI CCGC 3 cut(s) 154, 166, 179
TaaI ACNGT 2 cut(s) 59, 124
TaqI TCGA 1 cut(s) 48
TasI AATT 1 cut(s) 44
TscAI CASTG 1 cut(s) 64
TspGWI ACGGA 2 cut(s) 116, 188
TspRI CASTG 1 cut(s) 64
XagI CCTNNNNNAGG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.