Rmu_sc0007406.1_g000015

Signal recognition particle receptor beta subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007406.1
Physical Location & Seq
Reverse (-)
42778 .. 44354
1577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007406.1_g000015.1.cds

Sequence Viewer

Length: 636 bp
atgccttgggagagagtggagagaattgggttccgggagctggcgagtagtagcggtgagtatggtggagagaagctgaagaaggaggagttgaatgcattgagggaaatgttcgaaacccgaaaaagggaggagctgaaatgggtgttggatgatgatgtggagataaaagaggagtggtttgatggtgagaatagggtgtcggacccgacgaagcggcggcgtggcgagggggaggtgattcagtttcttgttgagaggcttagtggtacggagttttcattagactggaagctctggtggatgatgaagcagtcaggtttggaattcactgaggggcaggttcttaaggttctgaatggacttggtgctaagaaatgttggaaacaggcactctgttgtggaatgggggaacagtcgccttccatgaattctagattcagacacaaactctatgttgttgatgctgctgatcctgataacttgagcacctcaagaggggaacttcatgatttgcttagcaaatcctcacttaatggtatcccattgctgatcctgggtaacaagattgatagaccgggagctctgagtaaacaagctttgactgatgaaatgcaagacacatcatggttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

211

Amino Acids

24.3

Weight (kDa)

5.34

Isoelectric Point (pI)

39.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 331
AciI CCGC 3 cut(s) 54, 217, 220
AclWI GGATC 2 cut(s) 467, 547
AcsI RAATTY 2 cut(s) 326, 430
AcuI CTGAAG 1 cut(s) 98
AfaI GTAC 1 cut(s) 271
AfiI CCNNNNNNNGG 4 cut(s) 40, 126, 127, 498
AflII CTTAAG 1 cut(s) 347
AgsI TTSAA 1 cut(s) 94
AjnI CCWGG 1 cut(s) 555
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
AluBI AGCT 6 cut(s) 40, 76, 136, 295, 584, 599
AluI AGCT 6 cut(s) 40, 76, 136, 295, 584, 599
Alw21I GWGCWC 2 cut(s) 491, 586
AlwI GGATC 2 cut(s) 467, 547
ApeKI GCWGC 1 cut(s) 467
ApoI RAATTY 2 cut(s) 326, 430
AspS9I GGNCC 1 cut(s) 205
AsuC2I CCSGG 2 cut(s) 35, 579
AsuHPI GGTGA 3 cut(s) 68, 200, 250
AsuII TTCGAA 1 cut(s) 114
AvaII GGWCC 1 cut(s) 205
BanII GRGCYC 1 cut(s) 586
Bbv12I GWGCWC 2 cut(s) 491, 586
BbvI GCAGC 1 cut(s) 454
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 557
BciVI GTATCC 1 cut(s) 551
BcnI CCSGG 2 cut(s) 35, 579
BfaI CTAG 1 cut(s) 435
BfrI CTTAAG 1 cut(s) 347
BfuAI ACCTGC 1 cut(s) 331
BfuI GTATCC 1 cut(s) 551
BisI GCNGC 3 cut(s) 218, 221, 468
BlpI GCTNAGC 1 cut(s) 518
BlsI GCNGC 3 cut(s) 219, 222, 469
Bme1390I CCNGG 3 cut(s) 35, 557, 579
Bme18I GGWCC 1 cut(s) 205
BmgT120I GGNCC 1 cut(s) 205
BmiI GGNNCC 2 cut(s) 32, 207
BmrFI CCNGG 3 cut(s) 35, 557, 579
BmsI GCATC 1 cut(s) 454
Bpu1102I GCTNAGC 1 cut(s) 518
Bpu14I TTCGAA 1 cut(s) 114
BpuEI CTTGAG 2 cut(s) 478, 505
BpuMI CCSGG 2 cut(s) 35, 579
BsaJI CCNNGG 2 cut(s) 5, 556
Bsc4I CCNNNNNNNGG 4 cut(s) 40, 126, 127, 498
Bse1I ACTGG 1 cut(s) 293
Bse3DI GCAATG 1 cut(s) 545
BseBI CCWGG 1 cut(s) 557
BseDI CCNNGG 2 cut(s) 5, 556
BseGI GGATG 2 cut(s) 157, 309
BseLI CCNNNNNNNGG 4 cut(s) 40, 126, 127, 498
BseMI GCAATG 1 cut(s) 545
BseMII CTCAG 2 cut(s) 324, 578
BseNI ACTGG 1 cut(s) 293
BseRI GAGGAG 3 cut(s) 101, 146, 188
BseXI GCAGC 1 cut(s) 454
BsiHKAI GWGCWC 2 cut(s) 491, 586
BsiSI CCGG 2 cut(s) 34, 578
BslI CCNNNNNNNGG 4 cut(s) 40, 126, 127, 498
BsmI GAATGC 1 cut(s) 100
Bsp119I TTCGAA 1 cut(s) 114
Bsp1286I GDGCHC 2 cut(s) 491, 586
Bsp143I GATC 2 cut(s) 472, 552
Bsp1720I GCTNAGC 1 cut(s) 518
BspACI CCGC 3 cut(s) 54, 217, 220
BspCNI CTCAG 2 cut(s) 325, 579
BspHI TCATGA 1 cut(s) 508
BspLI GGNNCC 2 cut(s) 32, 207
BspMI ACCTGC 1 cut(s) 331
BspPI GGATC 2 cut(s) 467, 547
BspT104I TTCGAA 1 cut(s) 114
BspTI CTTAAG 1 cut(s) 347
BsrDI GCAATG 1 cut(s) 545
BsrI ACTGG 1 cut(s) 293
BssECI CCNNGG 2 cut(s) 5, 556
BssMI GATC 2 cut(s) 472, 552
BssT1I CCWWGG 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 557
Bst4CI ACNGT 1 cut(s) 417
BstAFI CTTAAG 1 cut(s) 347
BstBI TTCGAA 1 cut(s) 114
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 5 cut(s) 263, 333, 372, 518, 587
BstF5I GGATG 2 cut(s) 157, 309
BstKTI GATC 2 cut(s) 475, 555
BstMBI GATC 2 cut(s) 472, 552
BstNI CCWGG 1 cut(s) 557
BstSCI CCNGG 3 cut(s) 33, 555, 577
BstV1I GCAGC 1 cut(s) 454
BsuI GTATCC 1 cut(s) 551
BtsCI GGATG 2 cut(s) 157, 309
BtsIMutI CAGTG 1 cut(s) 330
BveI ACCTGC 1 cut(s) 331
Cac8I GCNNGC 1 cut(s) 42
CciI TCATGA 1 cut(s) 508
Cfr13I GGNCC 1 cut(s) 205
Csp6I GTAC 1 cut(s) 270
CviAII CATG 3 cut(s) 427, 509, 627
CviJI RGCY 7 cut(s) 40, 76, 136, 262, 295, 584, 599
CviKI_1 RGCY 7 cut(s) 40, 76, 136, 262, 295, 584, 599
CviQI GTAC 1 cut(s) 270
DdeI CTNAG 5 cut(s) 263, 333, 372, 518, 587
DpnI GATC 2 cut(s) 474, 554
DpnII GATC 2 cut(s) 472, 552
Ecl136II GAGCTC 1 cut(s) 584
Eco130I CCWWGG 1 cut(s) 5
Eco24I GRGCYC 1 cut(s) 586
Eco47I GGWCC 1 cut(s) 205
Eco53kI GAGCTC 1 cut(s) 584
Eco57I CTGAAG 1 cut(s) 98
EcoICRI GAGCTC 1 cut(s) 584
EcoRI GAATTC 2 cut(s) 326, 430
EcoRII CCWGG 1 cut(s) 555
EcoT14I CCWWGG 1 cut(s) 5
EcoT22I ATGCAT 1 cut(s) 100
EcoT38I GRGCYC 1 cut(s) 586
ErhI CCWWGG 1 cut(s) 5
FaeI CATG 3 cut(s) 430, 512, 630
FaiI YATR 5 cut(s) 63, 428, 456, 510, 628
FatI CATG 3 cut(s) 426, 508, 626
Fnu4HI GCNGC 3 cut(s) 218, 221, 468
FokI GGATG 2 cut(s) 164, 316
FriOI GRGCYC 1 cut(s) 586
Fsp4HI GCNGC 3 cut(s) 218, 221, 468
FspBI CTAG 1 cut(s) 435
GluI GCNGC 3 cut(s) 218, 221, 468
HapII CCGG 2 cut(s) 34, 578
Hin1II CATG 3 cut(s) 430, 512, 630
HindIII AAGCTT 1 cut(s) 597
HinfI GANTC 2 cut(s) 241, 438
HpaII CCGG 2 cut(s) 34, 578
HphI GGTGA 3 cut(s) 68, 200, 250
Hpy166II GTNNAC 1 cut(s) 593
Hpy188I TCNGA 4 cut(s) 205, 357, 443, 588
Hpy188III TCNNGA 4 cut(s) 435, 476, 495, 509
Hpy8I GTNNAC 1 cut(s) 593
Hpy99I CGWCG 1 cut(s) 214
HpyAV CCTTC 2 cut(s) 76, 432
HpyCH4III ACNGT 1 cut(s) 417
HpyCH4V TGCA 2 cut(s) 98, 616
HpyF3I CTNAG 5 cut(s) 263, 333, 372, 518, 587
Hsp92II CATG 3 cut(s) 430, 512, 630
Kzo9I GATC 2 cut(s) 472, 552
LmnI GCTCC 3 cut(s) 37, 133, 581
Lsp1109I GCAGC 1 cut(s) 454
LweI GCATC 1 cut(s) 454
MaeI CTAG 1 cut(s) 435
MaeIII GTNAC 1 cut(s) 560
MalI GATC 2 cut(s) 474, 554
MboI GATC 2 cut(s) 472, 552
MboII GAAGA 1 cut(s) 91
MhlI GDGCHC 2 cut(s) 491, 586
MluCI AATT 3 cut(s) 24, 326, 430
MmeI TCCRAC 3 cut(s) 129, 183, 362
Mph1103I ATGCAT 1 cut(s) 100
MseI TTAA 2 cut(s) 348, 534
MspCI CTTAAG 1 cut(s) 347
MspI CCGG 2 cut(s) 34, 578
MspR9I CCNGG 3 cut(s) 35, 557, 579
Mva1269I GAATGC 1 cut(s) 100
MvaI CCWGG 1 cut(s) 557
NciI CCSGG 2 cut(s) 35, 579
NdeII GATC 2 cut(s) 472, 552
NlaIII CATG 3 cut(s) 430, 512, 630
NlaIV GGNNCC 2 cut(s) 32, 207
NsiI ATGCAT 1 cut(s) 100
NspV TTCGAA 1 cut(s) 114
PagI TCATGA 1 cut(s) 508
PcsI WCGNNNNNNNCGW 1 cut(s) 209
PctI GAATGC 1 cut(s) 100
PfeI GAWTC 2 cut(s) 241, 438
PfoI TCCNGGA 1 cut(s) 33
PkrI GCNGC 3 cut(s) 219, 222, 469
Psp124BI GAGCTC 1 cut(s) 586
Psp6I CCWGG 1 cut(s) 555
PspGI CCWGG 1 cut(s) 555
PspN4I GGNNCC 2 cut(s) 32, 207
PspPI GGNCC 1 cut(s) 205
RsaI GTAC 1 cut(s) 271
RsaNI GTAC 1 cut(s) 270
SacI GAGCTC 1 cut(s) 586
SaqAI TTAA 2 cut(s) 348, 534
SatI GCNGC 3 cut(s) 218, 221, 468
Sau3AI GATC 2 cut(s) 472, 552
Sau96I GGNCC 1 cut(s) 205
ScrFI CCNGG 3 cut(s) 35, 557, 579
SduI GDGCHC 2 cut(s) 491, 586
SfaNI GCATC 1 cut(s) 454
SfuI TTCGAA 1 cut(s) 114
SinI GGWCC 1 cut(s) 205
SmlI CTYRAG 3 cut(s) 347, 484, 493
SmoI CTYRAG 3 cut(s) 347, 484, 493
Sse9I AATT 3 cut(s) 24, 326, 430
SsiI CCGC 3 cut(s) 54, 217, 220
SspMI CTAG 1 cut(s) 435
SstI GAGCTC 1 cut(s) 586
StyD4I CCNGG 3 cut(s) 33, 555, 577
StyI CCWWGG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 417
TaqI TCGA 1 cut(s) 114
TasI AATT 3 cut(s) 24, 326, 430
TauI GCSGC 2 cut(s) 220, 223
TfiI GAWTC 2 cut(s) 241, 438
Tru1I TTAA 2 cut(s) 348, 534
Tru9I TTAA 2 cut(s) 348, 534
TscAI CASTG 1 cut(s) 337
TseI GCWGC 1 cut(s) 467
TspDTI ATGAA 5 cut(s) 270, 323, 443, 497, 624
TspGWI ACGGA 1 cut(s) 287
TspRI CASTG 1 cut(s) 337
Vha464I CTTAAG 1 cut(s) 347
VpaK11BI GGWCC 1 cut(s) 205
XapI RAATTY 2 cut(s) 326, 430
XbaI TCTAGA 1 cut(s) 434
XspI CTAG 1 cut(s) 435
Zsp2I ATGCAT 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.