Rmu_sc0002530.1_g000017

Pentatricopeptide repeat-containing protein At5g67570

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002530.1
Physical Location & Seq
Reverse (-)
90175 .. 90474
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002530.1_g000017.1.cds

Sequence Viewer

Length: 300 bp
atggaagctctgcaaggagccctccctcaaatcccaaacccccaattccaaacaaacactgataaaatcaaacgcaacctcaccaacaaaggcgtacacccaactcccaaaatcgtccacactctccgcaagaaacaaatcgagaaacacaaccgcaaactcaaccgcctcgacgaacaagacccacctctctccgaatcccaaagccaagccctttccgaagaaacccatttccaaaccctggaagccgagtacagaagcttcaccagagccgtgaaatcaaaagaatggtggcgttga

Protein Analysis

99

Amino Acids

11.64

Weight (kDa)

9.75

Isoelectric Point (pI)

47.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 241
AciI CCGC 3 cut(s) 127, 154, 166
AfaI GTAC 2 cut(s) 96, 254
AfiI CCNNNNNNNGG 1 cut(s) 241
AjnI CCWGG 1 cut(s) 240
AluBI AGCT 2 cut(s) 8, 261
AluI AGCT 2 cut(s) 8, 261
AsuHPI GGTGA 2 cut(s) 73, 256
BanII GRGCYC 1 cut(s) 22
BarI GAAGNNNNNNTAC 2 cut(s) 245, 277
BceAI ACGGC 1 cut(s) 257
BciT130I CCWGG 1 cut(s) 242
Bme1390I CCNGG 1 cut(s) 242
BmiI GGNNCC 1 cut(s) 19
BmrFI CCNGG 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 240
Bsc4I CCNNNNNNNGG 1 cut(s) 241
BseBI CCWGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 240
BseLI CCNNNNNNNGG 1 cut(s) 241
BslI CCNNNNNNNGG 1 cut(s) 241
Bsp1286I GDGCHC 1 cut(s) 22
BspACI CCGC 3 cut(s) 127, 154, 166
BspLI GGNNCC 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 240
Bst2UI CCWGG 1 cut(s) 242
BstNI CCWGG 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 240
BtsIMutI CAGTG 1 cut(s) 57
Csp6I GTAC 2 cut(s) 95, 253
CviJI RGCY 7 cut(s) 8, 20, 207, 212, 248, 261, 272
CviKI_1 RGCY 7 cut(s) 8, 20, 207, 212, 248, 261, 272
CviQI GTAC 2 cut(s) 95, 253
Eco24I GRGCYC 1 cut(s) 22
EcoRII CCWGG 1 cut(s) 240
EcoT38I GRGCYC 1 cut(s) 22
FriOI GRGCYC 1 cut(s) 22
HindIII AAGCTT 1 cut(s) 259
HinfI GANTC 1 cut(s) 197
HphI GGTGA 2 cut(s) 73, 256
Hpy166II GTNNAC 2 cut(s) 97, 118
Hpy188I TCNGA 2 cut(s) 196, 220
Hpy188III TCNNGA 1 cut(s) 142
Hpy8I GTNNAC 2 cut(s) 97, 118
Hpy99I CGWCG 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 13
LmnI GCTCC 1 cut(s) 17
LpnPI CCDG 3 cut(s) 227, 254, 280
MboII GAAGA 1 cut(s) 233
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 1 cut(s) 44
MnlI CCTC 5 cut(s) 32, 36, 89, 179, 198
MspR9I CCNGG 1 cut(s) 242
MvaI CCWGG 1 cut(s) 242
NlaIV GGNNCC 1 cut(s) 19
NmeAIII GCCGAG 1 cut(s) 274
PfeI GAWTC 1 cut(s) 197
PflMI CCANNNNNTGG 1 cut(s) 241
Psp6I CCWGG 1 cut(s) 240
PspGI CCWGG 1 cut(s) 240
PspN4I GGNNCC 1 cut(s) 19
RsaI GTAC 2 cut(s) 96, 254
RsaNI GTAC 2 cut(s) 95, 253
ScrFI CCNGG 1 cut(s) 242
SduI GDGCHC 1 cut(s) 22
SetI ASST 4 cut(s) 10, 81, 190, 263
Sse9I AATT 1 cut(s) 44
SsiI CCGC 3 cut(s) 127, 154, 166
StyD4I CCNGG 1 cut(s) 240
TaqI TCGA 2 cut(s) 141, 171
TasI AATT 1 cut(s) 44
TatI WGTACW 1 cut(s) 252
TfiI GAWTC 1 cut(s) 197
TscAI CASTG 1 cut(s) 64
TspRI CASTG 1 cut(s) 64
Van91I CCANNNNNTGG 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.