MD05G1049100.v1.1
MADS Family

MADS

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0008928
Physical Location & Seq
Forward (+)
8415846 .. 8416209
364 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1049100.v1.1.491

Sequence Viewer

Length: 288 bp
ATGGGGAGAGGAAAGATTGTGATTAGAAGGATTGACAATTCAACAAGCAGGCAAGTGACCTTCTCGAAGAGAAGAAGTGGGTTGCTTAAGAAGGCTAAGGAGCTATCAATCCTTTGTGATGCTGAGGTTGGATTGATTGTCTTCTCAGGCACCGGCAGGCTTTACGATTATGCTAGCACTAGAGAAATATTGTTGTCATGTGAAATTTTTGCATACCCGAAGATGTTATTATTGCATAAAATACTGATTTTTTTTATGAATCTATATATAGCATGTGAAATTACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SRF-TF

Protein Analysis

96

Amino Acids

10.85

Weight (kDa)

9.67

Isoelectric Point (pI)

59.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 10 - 57 8.4e-26 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 149
AcsI RAATTY 1 cut(s) 204
AflII CTTAAG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 42
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
ApoI RAATTY 1 cut(s) 204
AsuNHI GCTAGC 1 cut(s) 173
BanI GGYRCC 1 cut(s) 149
BbsI GAAGAC 1 cut(s) 133
BbvCI CCTCAGC 1 cut(s) 123
BfaI CTAG 2 cut(s) 174, 180
BfrI CTTAAG 1 cut(s) 86
BmiI GGNNCC 1 cut(s) 151
BmsI GCATC 1 cut(s) 109
BmtI GCTAGC 1 cut(s) 177
BpiI GAAGAC 1 cut(s) 133
Bpu10I CCTNAGC 2 cut(s) 96, 123
Bse118I RCCGGY 1 cut(s) 152
BseMII CTCAG 2 cut(s) 114, 159
BshNI GGYRCC 1 cut(s) 149
BsiSI CCGG 1 cut(s) 153
BspCNI CTCAG 2 cut(s) 115, 158
BspLI GGNNCC 1 cut(s) 151
BspOI GCTAGC 1 cut(s) 177
BspT107I GGYRCC 1 cut(s) 149
BspTI CTTAAG 1 cut(s) 86
BsrFI RCCGGY 1 cut(s) 152
BssAI RCCGGY 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 62
BstAFI CTTAAG 1 cut(s) 86
BstC8I GCNNGC 3 cut(s) 50, 158, 175
BstDEI CTNAG 3 cut(s) 96, 123, 145
BstNSI RCATGY 1 cut(s) 276
BstV2I GAAGAC 1 cut(s) 133
Cac8I GCNNGC 3 cut(s) 50, 158, 175
Cfr10I RCCGGY 1 cut(s) 152
CviAII CATG 2 cut(s) 198, 273
CviJI RGCY 3 cut(s) 95, 103, 160
CviKI_1 RGCY 3 cut(s) 95, 103, 160
DdeI CTNAG 3 cut(s) 96, 123, 145
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
FaeI CATG 2 cut(s) 201, 276
FaiI YATR 9 cut(s) 171, 199, 214, 237, 257, 265, 267, 269, 274
FatI CATG 2 cut(s) 197, 272
FspBI CTAG 2 cut(s) 174, 180
HapII CCGG 1 cut(s) 153
Hin1II CATG 2 cut(s) 201, 276
HinfI GANTC 1 cut(s) 259
HpaII CCGG 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 64
HpyAV CCTTC 3 cut(s) 21, 70, 85
HpyCH4V TGCA 2 cut(s) 212, 235
HpyF3I CTNAG 3 cut(s) 96, 123, 145
Hsp92II CATG 2 cut(s) 201, 276
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 4 cut(s) 34, 132, 142, 166
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 174, 180
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 4 cut(s) 79, 84, 133, 232
MluCI AATT 3 cut(s) 37, 204, 279
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 1 cut(s) 118
MseI TTAA 2 cut(s) 87, 286
MspCI CTTAAG 1 cut(s) 86
MspI CCGG 1 cut(s) 153
NheI GCTAGC 1 cut(s) 173
NlaIII CATG 2 cut(s) 201, 276
NlaIV GGNNCC 1 cut(s) 151
NmuCI GTSAC 1 cut(s) 55
NspI RCATGY 1 cut(s) 276
PfeI GAWTC 1 cut(s) 259
PspN4I GGNNCC 1 cut(s) 151
SaqAI TTAA 2 cut(s) 87, 286
SetI ASST 3 cut(s) 62, 105, 129
SfaNI GCATC 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 3 cut(s) 37, 204, 279
SspI AATATT 1 cut(s) 189
SspMI CTAG 2 cut(s) 174, 180
TaqI TCGA 1 cut(s) 65
TasI AATT 3 cut(s) 37, 204, 279
TfiI GAWTC 1 cut(s) 259
Tru1I TTAA 2 cut(s) 87, 286
Tru9I TTAA 2 cut(s) 87, 286
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspDTI ATGAA 1 cut(s) 272
Vha464I CTTAAG 1 cut(s) 86
XapI RAATTY 1 cut(s) 204
XceI RCATGY 1 cut(s) 276
XspI CTAG 2 cut(s) 174, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.