MD10G1055900.v1.1
MADS Family

MADS-box transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0008928
Physical Location & Seq
Forward (+)
7672587 .. 7672869
283 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1055900.v1.1.491

Sequence Viewer

Length: 198 bp
ATGGGGAGAGGAAAGGTTGTGATTCGAAGGATTGACAATTTGACGAGCAGGCAAGTGACCTTTTCGAAGAGAAGAAATGGGTTGCTTAAGAAGGCTAAGGAGCTATCAATCCTTTGTGATGCTGAGGTTGGATTGATTATCTTCTCTAGCACCGGCAGGCTTTACGATTATGCTAGCACTAGTTTGCACTGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
K-box SRF-TF

Protein Analysis

66

Amino Acids

7.38

Weight (kDa)

10.36

Isoelectric Point (pI)

47.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 10 - 57 4.3e-26 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 86
AhlI ACTAGT 1 cut(s) 179
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
AsuII TTCGAA 2 cut(s) 25, 65
AsuNHI GCTAGC 1 cut(s) 173
BbvCI CCTCAGC 1 cut(s) 123
BcuI ACTAGT 1 cut(s) 179
BfaI CTAG 4 cut(s) 147, 174, 180, 196
BfrI CTTAAG 1 cut(s) 86
BmsI GCATC 1 cut(s) 109
BmtI GCTAGC 1 cut(s) 177
Bpu10I CCTNAGC 2 cut(s) 96, 123
Bpu14I TTCGAA 2 cut(s) 25, 65
Bse118I RCCGGY 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 194
BseMII CTCAG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 194
BsiSI CCGG 1 cut(s) 153
Bsp119I TTCGAA 2 cut(s) 25, 65
BspCNI CTCAG 1 cut(s) 115
BspOI GCTAGC 1 cut(s) 177
BspT104I TTCGAA 2 cut(s) 25, 65
BspTI CTTAAG 1 cut(s) 86
BsrFI RCCGGY 1 cut(s) 152
BsrI ACTGG 1 cut(s) 194
BssAI RCCGGY 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 62
BstAFI CTTAAG 1 cut(s) 86
BstBI TTCGAA 2 cut(s) 25, 65
BstC8I GCNNGC 3 cut(s) 50, 158, 175
BstDEI CTNAG 2 cut(s) 96, 123
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 3 cut(s) 50, 158, 175
Cfr10I RCCGGY 1 cut(s) 152
CviJI RGCY 3 cut(s) 95, 103, 160
CviKI_1 RGCY 3 cut(s) 95, 103, 160
DdeI CTNAG 2 cut(s) 96, 123
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
FaiI YATR 1 cut(s) 171
FspBI CTAG 4 cut(s) 147, 174, 180, 196
HapII CCGG 1 cut(s) 153
HinfI GANTC 1 cut(s) 22
HpaII CCGG 1 cut(s) 153
HpyAV CCTTC 2 cut(s) 21, 85
HpyCH4V TGCA 1 cut(s) 187
HpyF3I CTNAG 2 cut(s) 96, 123
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 4 cut(s) 34, 142, 166, 175
LweI GCATC 1 cut(s) 109
MaeI CTAG 4 cut(s) 147, 174, 180, 196
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 3 cut(s) 79, 84, 133
MluCI AATT 1 cut(s) 37
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 1 cut(s) 118
MseI TTAA 1 cut(s) 87
MspCI CTTAAG 1 cut(s) 86
MspI CCGG 1 cut(s) 153
NheI GCTAGC 1 cut(s) 173
NmuCI GTSAC 1 cut(s) 55
NspV TTCGAA 2 cut(s) 25, 65
PfeI GAWTC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 87
SetI ASST 4 cut(s) 18, 62, 105, 129
SfaNI GCATC 1 cut(s) 109
SfuI TTCGAA 2 cut(s) 25, 65
SgeI CNNG 8 cut(s) 57, 61, 65, 159, 165, 169, 186, 192
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
SpeI ACTAGT 1 cut(s) 179
Sse9I AATT 1 cut(s) 37
SspMI CTAG 4 cut(s) 147, 174, 180, 196
TaqI TCGA 2 cut(s) 25, 65
TasI AATT 1 cut(s) 37
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 194
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
TspRI CASTG 1 cut(s) 194
Vha464I CTTAAG 1 cut(s) 86
XspI CTAG 4 cut(s) 147, 174, 180, 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.