MD06G1163200.v1.1

transcription regulatory region sequence-specific DNA binding

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Forward (+)
30390984 .. 30399217
8234 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1163200.v1.1.491

Sequence Viewer

Length: 135 bp
ATGTCGATTCTGTGTGAATCTGAAGCTGTTGTTATCATCTTTTCTCAAACTGGCAAGCTCCTTGATTTCTCAAGCTCCAGGTATGGATTTTATGGGAGGCGTCTAGAAAGTTCCAACTTTTATCTTCATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

45

Amino Acids

5.05

Weight (kDa)

6.52

Isoelectric Point (pI)

70.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 42
AcyI GRCGYC 1 cut(s) 100
AjnI CCWGG 1 cut(s) 77
AluBI AGCT 3 cut(s) 26, 58, 75
AluI AGCT 3 cut(s) 26, 58, 75
BciT130I CCWGG 1 cut(s) 79
BfaI CTAG 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 79
BpmI CTGGAG 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 55
BsaHI GRCGYC 1 cut(s) 100
Bse1I ACTGG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 79
BseNI ACTGG 1 cut(s) 55
BsrI ACTGG 1 cut(s) 55
BssNI GRCGYC 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 79
BstACI GRCGYC 1 cut(s) 100
BstC8I GCNNGC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 56
CseI GACGC 1 cut(s) 89
CviAII CATG 1 cut(s) 128
CviJI RGCY 3 cut(s) 26, 58, 75
CviKI_1 RGCY 3 cut(s) 26, 58, 75
Eco57I CTGAAG 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 77
FaeI CATG 1 cut(s) 131
FaiI YATR 3 cut(s) 84, 93, 129
FatI CATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 104
FspEI CC 9 cut(s) 36, 64, 69, 74, 78, 79, 82, 91, 127
GsuI CTGGAG 1 cut(s) 61
HgaI GACGC 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 100
Hin1II CATG 1 cut(s) 131
HinfI GANTC 2 cut(s) 7, 17
Hpy188I TCNGA 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 104
Hsp92I GRCGYC 1 cut(s) 100
Hsp92II CATG 1 cut(s) 131
LmnI GCTCC 2 cut(s) 63, 80
LpnPI CCDG 3 cut(s) 36, 64, 91
MaeI CTAG 1 cut(s) 104
MboII GAAGA 1 cut(s) 116
MnlI CCTC 1 cut(s) 90
MseI TTAA 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 79
NlaIII CATG 1 cut(s) 131
PfeI GAWTC 2 cut(s) 7, 17
Psp6I CCWGG 1 cut(s) 77
PspGI CCWGG 1 cut(s) 77
SaqAI TTAA 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 79
SetI ASST 4 cut(s) 28, 60, 77, 83
SgeI CNNG 7 cut(s) 63, 67, 74, 84, 90, 91, 116
SmlI CTYRAG 1 cut(s) 70
SmoI CTYRAG 1 cut(s) 70
SspMI CTAG 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 77
TaqI TCGA 1 cut(s) 5
TfiI GAWTC 2 cut(s) 7, 17
Tru1I TTAA 1 cut(s) 133
Tru9I TTAA 1 cut(s) 133
TspDTI ATGAA 1 cut(s) 116
XbaI TCTAGA 1 cut(s) 103
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.