RchiOBHm_Chr7g0233561

transcription regulatory region sequence-specific DNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0008928
Physical Location & Seq
Reverse (-)
58043019 .. 58043204
186 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20936

Sequence Viewer

Length: 186 bp
ATGGGAAGGGGAAAGATTGTGATAAGGAGGATTGACAATTCAACGAGCAGGCAGGTGACGTTTTCGAAGCGGAGGAATGGATTGTTGAAGAAGGCCAGAGAACTGGCTATCCTGTGCGATGCTGAGGTCGGAGTCATGATCTTCTCCAGCACCGGCAAGCTCTACGATTTCGCAAGCACCAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04022 ko04371 ko05418 map04013 map04022 map04371 map05418
Pfam Domains
Protein Families
K-box SRF-TF

Protein Analysis

61

Amino Acids

6.86

Weight (kDa)

10.94

Isoelectric Point (pI)

38.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRF-TF PF00319 10 - 57 9.9e-27 SRF-type transcription factor (DNA-binding and dimerisation domain)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 43
Acc36I ACCTGC 1 cut(s) 43
AciI CCGC 1 cut(s) 70
AgsI TTSAA 2 cut(s) 42, 88
AjnI CCWGG 1 cut(s) 179
AloI GAACNNNNNNTCC 2 cut(s) 93, 125
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
AoxI GGCC 1 cut(s) 93
AsuHPI GGTGA 1 cut(s) 67
AsuII TTCGAA 1 cut(s) 65
BbvCI CCTCAGC 1 cut(s) 123
BciT130I CCWGG 1 cut(s) 181
BfuAI ACCTGC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 181
BmsI GCATC 1 cut(s) 109
BpmI CTGGAG 1 cut(s) 130
Bpu10I CCTNAGC 1 cut(s) 123
Bpu14I TTCGAA 1 cut(s) 65
Bse118I RCCGGY 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 114
BseNI ACTGG 1 cut(s) 108
BshFI GGCC 1 cut(s) 95
BsiSI CCGG 1 cut(s) 153
BsnI GGCC 1 cut(s) 95
Bsp119I TTCGAA 1 cut(s) 65
Bsp143I GATC 1 cut(s) 138
BspACI CCGC 1 cut(s) 70
BspANI GGCC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 115
BspHI TCATGA 1 cut(s) 135
BspMI ACCTGC 1 cut(s) 43
BspT104I TTCGAA 1 cut(s) 65
BsrFI RCCGGY 1 cut(s) 152
BsrI ACTGG 1 cut(s) 108
BssAI RCCGGY 1 cut(s) 152
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 181
BstBI TTCGAA 1 cut(s) 65
BstC8I GCNNGC 3 cut(s) 50, 158, 175
BstDEI CTNAG 1 cut(s) 123
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 181
BstSCI CCNGG 1 cut(s) 179
BstXI CCANNNNNNTGG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 95
BtgZI GCGATG 1 cut(s) 132
BveI ACCTGC 1 cut(s) 43
Cac8I GCNNGC 3 cut(s) 50, 158, 175
CciI TCATGA 1 cut(s) 135
Cfr10I RCCGGY 1 cut(s) 152
CsiI ACCWGGT 1 cut(s) 179
CviAII CATG 1 cut(s) 136
CviJI RGCY 3 cut(s) 95, 107, 160
CviKI_1 RGCY 3 cut(s) 95, 107, 160
DdeI CTNAG 1 cut(s) 123
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 179
FaeI CATG 1 cut(s) 139
FaiI YATR 1 cut(s) 137
FatI CATG 1 cut(s) 135
GsuI CTGGAG 1 cut(s) 130
HaeIII GGCC 1 cut(s) 95
HapII CCGG 1 cut(s) 153
Hin1II CATG 1 cut(s) 139
HinfI GANTC 1 cut(s) 132
HpaII CCGG 1 cut(s) 153
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 131
Hpy188III TCNNGA 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 59
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 8 cut(s) 34, 38, 89, 109, 125, 160, 166, 166
LweI GCATC 1 cut(s) 109
MabI ACCWGGT 1 cut(s) 179
MaeII ACGT 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 55
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 2 cut(s) 100, 133
MluCI AATT 1 cut(s) 37
MlyI GAGTC 1 cut(s) 141
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 3 cut(s) 21, 66, 118
MspI CCGG 1 cut(s) 153
MspR9I CCNGG 1 cut(s) 181
MvaI CCWGG 1 cut(s) 181
NdeII GATC 1 cut(s) 138
NlaIII CATG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 55
NspV TTCGAA 1 cut(s) 65
PagI TCATGA 1 cut(s) 135
PaqCI CACCTGC 1 cut(s) 43
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 179
PspGI CCWGG 1 cut(s) 179
Sau3AI GATC 1 cut(s) 138
SchI GAGTC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 181
SetI ASST 5 cut(s) 57, 62, 129, 162, 185
SexAI ACCWGGT 1 cut(s) 179
SfaNI GCATC 1 cut(s) 109
SfuI TTCGAA 1 cut(s) 65
Sse9I AATT 1 cut(s) 37
SsiI CCGC 1 cut(s) 70
StyD4I CCNGG 1 cut(s) 179
TaiI ACGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 65
TasI AATT 1 cut(s) 37
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.