Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002409.1

Orthogroup ID

OG0008928

Physical Location & Seq

Genomic Coordinates Reverse (-)

6392 .. 11147

Gene Structure 4756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002409.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

atgggaaggggaaagattgtgataaggaggattgacaattcaacgagcaggcaggtgacgttttcgaagcggaggaatggattgttgaagaaggccagagaactggcgatcctgtgcgatgctgaggtcggagtcatgatcttctccagcaccggcaagctctacgatttcgcaagcaccagatctacggtctcgaccaccaccttcatagctacctccaccctcgcttccatagctatcacctccatggctgtagccattgtctccaccctcacgacaaccactgccaccataacctccaccgccacttctgtagccactgccttcccctttacgaggaccaccatcaccaccaccaccgctttcgcgggactaagcctcattgactgtgatgctatgaccgtcaaggtcctagccattcatgcctttgattatgtctctcatggccttctcgttgctgaaggtgacgaatctaaatcccctggaccttctggtctcacgatcgttgatgatcttcaattcgatgatcttgccaaaaggagcgaaggccctttcaagcacaacgttgtctgtggcccaggtgagcctttcaatgaatcaatggaacttgatctcagcagaggccataacgagaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SRF-TF

Protein Analysis

212

Amino Acids

22.59

Weight (kDa)

6.9

Isoelectric Point (pI)

38.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008928)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g11353 FvH4_4g19210 FvH4_5g29232
malus_domestica	MD05G1049100.v1.1 MD05G1049400.v1.1 MD06G1163200.v1.1 MD09G1074000.v1.1 MD09G1075200.v1.1 MD10G1055900.v1.1 MD10G1306300.v1.1
prunus_persica	Prupe.1G531300_v2.0.a1 Prupe.1G531500_v2.0.a1 Prupe.1G538700_v2.0.a1
pyrus_communis	pycom08g16930 pycom09g00120 pycom15g27670
rosa_chinensis	RchiOBHm_Chr6g0270001 RchiOBHm_Chr7g0233561
rosa_multiflora	Rmu_sc0002409.1_g000001 Rmu_sc0008851.1_g000013
rosa_roxburghii	Rroxscaffold_3G00227180 Rroxscaffold_5G00351090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	43
AasI	GACNNNNNNGTC	1 cut(s)	492
Acc36I	ACCTGC	1 cut(s)	43
AccII	CGCG	1 cut(s)	368
AciI	CCGC	4 cut(s)	70, 303, 360, 368
AclI	AACGTT	1 cut(s)	564
AclWI	GGATC	1 cut(s)	103
AcuI	CTGAAG	1 cut(s)	480
AfiI	CCNNNNNNNGG	1 cut(s)	336
AgsI	TTSAA	5 cut(s)	42, 88, 518, 556, 592
AjnI	CCWGG	2 cut(s)	481, 577
AloI	GAACNNNNNNTCC	2 cut(s)	93, 125
AluBI	AGCT	3 cut(s)	160, 212, 236
AluI	AGCT	3 cut(s)	160, 212, 236
Alw26I	GTCTC	4 cut(s)	196, 268, 442, 500
AlwI	GGATC	1 cut(s)	103
AoxI	GGCC	5 cut(s)	93, 445, 547, 574, 622
AspS9I	GGNCC	5 cut(s)	339, 409, 485, 548, 575
AsuHPI	GGTGA	5 cut(s)	67, 232, 340, 476, 593
AsuII	TTCGAA	1 cut(s)	65
AvaII	GGWCC	3 cut(s)	339, 409, 485
BbvCI	CCTCAGC	1 cut(s)	123
BccI	CCATC	1 cut(s)	353
BcgI	CGANNNNNNTGC	2 cut(s)	512, 546
BciT130I	CCWGG	2 cut(s)	483, 579
BcoDI	GTCTC	4 cut(s)	196, 268, 442, 500
BfaI	CTAG	1 cut(s)	413
BfmI	CTRYAG	2 cut(s)	252, 312
BfuAI	ACCTGC	1 cut(s)	43
BglII	AGATCT	1 cut(s)	182
Bme1390I	CCNGG	2 cut(s)	483, 579
Bme18I	GGWCC	3 cut(s)	339, 409, 485
BmgT120I	GGNCC	5 cut(s)	339, 409, 485, 548, 575
BmrFI	CCNGG	2 cut(s)	483, 579
BmsI	GCATC	2 cut(s)	109, 382
BpmI	CTGGAG	1 cut(s)	130
Bpu10I	CCTNAGC	1 cut(s)	123
Bpu14I	TTCGAA	1 cut(s)	65
BsaI	GGTCTC	2 cut(s)	196, 500
BsaJI	CCNNGG	3 cut(s)	246, 481, 577
Bsc4I	CCNNNNNNNGG	1 cut(s)	336
Bse118I	RCCGGY	1 cut(s)	152
Bse1I	ACTGG	1 cut(s)	108
BseBI	CCWGG	2 cut(s)	483, 579
BseDI	CCNNGG	3 cut(s)	246, 481, 577
BseLI	CCNNNNNNNGG	1 cut(s)	336
BseMII	CTCAG	2 cut(s)	114, 628
BseNI	ACTGG	1 cut(s)	108
Bsh1236I	CGCG	1 cut(s)	368
Bsh1285I	CGRYCG	1 cut(s)	504
BshFI	GGCC	5 cut(s)	95, 447, 549, 576, 624
BsiEI	CGRYCG	1 cut(s)	504
BsiSI	CCGG	1 cut(s)	153
BslFI	GGGAC	1 cut(s)	384
BslI	CCNNNNNNNGG	1 cut(s)	336
BsmAI	GTCTC	4 cut(s)	196, 268, 442, 500
BsmFI	GGGAC	1 cut(s)	384
BsnI	GGCC	5 cut(s)	95, 447, 549, 576, 624
Bso31I	GGTCTC	2 cut(s)	196, 500
Bsp119I	TTCGAA	1 cut(s)	65
Bsp143I	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
Bsp19I	CCATGG	1 cut(s)	246
BspACI	CCGC	4 cut(s)	70, 303, 360, 368
BspANI	GGCC	5 cut(s)	95, 447, 549, 576, 624
BspCNI	CTCAG	2 cut(s)	115, 627
BspFNI	CGCG	1 cut(s)	368
BspHI	TCATGA	1 cut(s)	135
BspMI	ACCTGC	1 cut(s)	43
BspPI	GGATC	1 cut(s)	103
BspT104I	TTCGAA	1 cut(s)	65
BspTNI	GGTCTC	2 cut(s)	196, 500
BsrFI	RCCGGY	1 cut(s)	152
BsrI	ACTGG	1 cut(s)	108
BssAI	RCCGGY	1 cut(s)	152
BssECI	CCNNGG	3 cut(s)	246, 481, 577
BssMI	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
BssT1I	CCWWGG	1 cut(s)	246
Bst2UI	CCWGG	2 cut(s)	483, 579
Bst4CI	ACNGT	3 cut(s)	190, 389, 403
BstBI	TTCGAA	1 cut(s)	65
BstC8I	GCNNGC	3 cut(s)	50, 158, 175
BstDEI	CTNAG	3 cut(s)	123, 374, 614
BstDSI	CCRYGG	1 cut(s)	246
BstENI	CCTNNNNNAGG	1 cut(s)	334
BstFNI	CGCG	1 cut(s)	368
BstKTI	GATC	7 cut(s)	111, 141, 185, 504, 514, 529, 613
BstMAI	GTCTC	4 cut(s)	196, 268, 442, 500
BstMBI	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
BstMCI	CGRYCG	1 cut(s)	504
BstMWI	GCNNNNNNNGC	2 cut(s)	233, 422
BstNI	CCWGG	2 cut(s)	483, 579
BstSCI	CCNGG	2 cut(s)	481, 577
BstSFI	CTRYAG	2 cut(s)	252, 312
BstUI	CGCG	1 cut(s)	368
BstX2I	RGATCY	1 cut(s)	182
BstXI	CCANNNNNNTGG	1 cut(s)	103
BstYI	RGATCY	1 cut(s)	182
BsuRI	GGCC	5 cut(s)	95, 447, 549, 576, 624
BtgI	CCRYGG	1 cut(s)	246
BtgZI	GCGATG	1 cut(s)	132
BtsI	GCAGTG	2 cut(s)	282, 318
BtsIMutI	CAGTG	2 cut(s)	282, 318
BveI	ACCTGC	1 cut(s)	43
Cac8I	GCNNGC	3 cut(s)	50, 158, 175
CciI	TCATGA	1 cut(s)	135
Cfr10I	RCCGGY	1 cut(s)	152
Cfr13I	GGNCC	5 cut(s)	339, 409, 485, 548, 575
CviAII	CATG	4 cut(s)	136, 247, 422, 443
DdeI	CTNAG	3 cut(s)	123, 374, 614
DpnI	GATC	7 cut(s)	110, 140, 184, 503, 513, 528, 612
DpnII	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
DrdI	GACNNNNNNGTC	1 cut(s)	492
DseDI	GACNNNNNNGTC	1 cut(s)	492
Eco130I	CCWWGG	1 cut(s)	246
Eco31I	GGTCTC	2 cut(s)	196, 500
Eco47I	GGWCC	3 cut(s)	339, 409, 485
Eco57I	CTGAAG	1 cut(s)	480
EcoNI	CCTNNNNNAGG	1 cut(s)	334
EcoO109I	RGGNCCY	2 cut(s)	409, 548
EcoRII	CCWGG	2 cut(s)	481, 577
EcoT14I	CCWWGG	1 cut(s)	246
ErhI	CCWWGG	1 cut(s)	246
FaeI	CATG	4 cut(s)	139, 250, 425, 446
FaqI	GGGAC	1 cut(s)	384
FatI	CATG	4 cut(s)	135, 246, 421, 442
FauI	CCCGC	1 cut(s)	361
FspBI	CTAG	1 cut(s)	413
GsuI	CTGGAG	1 cut(s)	130
HaeIII	GGCC	5 cut(s)	95, 447, 549, 576, 624
HapII	CCGG	1 cut(s)	153
Hin1II	CATG	4 cut(s)	139, 250, 425, 446
HinfI	GANTC	3 cut(s)	132, 470, 596
HpaII	CCGG	1 cut(s)	153
HphI	GGTGA	5 cut(s)	67, 232, 340, 476, 593
Hpy188I	TCNGA	1 cut(s)	131
Hpy188III	TCNNGA	4 cut(s)	136, 193, 274, 499
HpyAV	CCTTC	7 cut(s)	85, 214, 334, 455, 458, 498, 539
HpyCH4III	ACNGT	3 cut(s)	190, 389, 403
HpyCH4IV	ACGT	2 cut(s)	59, 564
HpyF10VI	GCNNNNNNNGC	2 cut(s)	233, 422
HpyF3I	CTNAG	3 cut(s)	123, 374, 614
HpySE526I	ACGT	2 cut(s)	59, 564
Hsp92II	CATG	4 cut(s)	139, 250, 425, 446
Kzo9I	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
LmnI	GCTCC	1 cut(s)	540
LweI	GCATC	2 cut(s)	109, 382
MaeI	CTAG	1 cut(s)	413
MaeII	ACGT	2 cut(s)	59, 564
MaeIII	GTNAC	2 cut(s)	55, 464
MalI	GATC	7 cut(s)	110, 140, 184, 503, 513, 528, 612
MboI	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
MboII	GAAGA	3 cut(s)	100, 133, 506
MflI	RGATCY	1 cut(s)	182
MluCI	AATT	2 cut(s)	37, 518
MlyI	GAGTC	1 cut(s)	141
MmeI	TCCRAC	1 cut(s)	109
MslI	CAYNNNNRTG	1 cut(s)	245
MspI	CCGG	1 cut(s)	153
MspR9I	CCNGG	2 cut(s)	483, 579
MvaI	CCWGG	2 cut(s)	483, 579
MvnI	CGCG	1 cut(s)	368
MwoI	GCNNNNNNNGC	2 cut(s)	233, 422
NcoI	CCATGG	1 cut(s)	246
NdeII	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
NlaIII	CATG	4 cut(s)	139, 250, 425, 446
NmuCI	GTSAC	2 cut(s)	55, 464
NspV	TTCGAA	1 cut(s)	65
PagI	TCATGA	1 cut(s)	135
PaqCI	CACCTGC	1 cut(s)	43
PfeI	GAWTC	2 cut(s)	470, 596
Ple19I	CGATCG	1 cut(s)	504
PleI	GAGTC	1 cut(s)	140
PpsI	GAGTC	1 cut(s)	140
PpuMI	RGGWCCY	1 cut(s)	409
Psp1406I	AACGTT	1 cut(s)	564
Psp5II	RGGWCCY	1 cut(s)	409
Psp6I	CCWGG	2 cut(s)	481, 577
PspGI	CCWGG	2 cut(s)	481, 577
PspPI	GGNCC	5 cut(s)	339, 409, 485, 548, 575
PspPPI	RGGWCCY	1 cut(s)	409
PsuI	RGATCY	1 cut(s)	182
PvuI	CGATCG	1 cut(s)	504
RseI	CAYNNNNRTG	1 cut(s)	245
Sau3AI	GATC	7 cut(s)	108, 138, 182, 501, 511, 526, 610
Sau96I	GGNCC	5 cut(s)	339, 409, 485, 548, 575
SchI	GAGTC	1 cut(s)	141
ScrFI	CCNGG	2 cut(s)	483, 579
SfaNI	GCATC	2 cut(s)	109, 382
SfcI	CTRYAG	2 cut(s)	252, 312
SfuI	TTCGAA	1 cut(s)	65
SinI	GGWCC	3 cut(s)	339, 409, 485
SmiMI	CAYNNNNRTG	1 cut(s)	245
Sse9I	AATT	2 cut(s)	37, 518
SsiI	CCGC	4 cut(s)	70, 303, 360, 368
SspMI	CTAG	1 cut(s)	413
StyD4I	CCNGG	2 cut(s)	481, 577
StyI	CCWWGG	1 cut(s)	246
TaaI	ACNGT	3 cut(s)	190, 389, 403
TaiI	ACGT	2 cut(s)	62, 567
TaqI	TCGA	3 cut(s)	65, 194, 522
TasI	AATT	2 cut(s)	37, 518
TfiI	GAWTC	2 cut(s)	470, 596
TscAI	CASTG	2 cut(s)	289, 325
TseFI	GTSAC	2 cut(s)	55, 464
Tsp45I	GTSAC	2 cut(s)	55, 464
TspDTI	ATGAA	3 cut(s)	196, 410, 609
TspRI	CASTG	2 cut(s)	289, 325
VpaK11BI	GGWCC	3 cut(s)	339, 409, 485
XagI	CCTNNNNNAGG	1 cut(s)	334
XspI	CTAG	1 cut(s)	413

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.