Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0008928

Physical Location & Seq

Genomic Coordinates Reverse (-)

27616401 .. 27616667

Gene Structure 267 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ24221

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

ATGGGGAGAGGCAAGATTGTGATCCGAAGGATTGACAATTCGACGAGCAGACAAGTGACGTTTTCCAAGCGAAGAAATGGGCTGCTGAAGAAGGCTAAGGAGCTTTCAGTCCTTTGTGATGCTGAGGTTGGACTGATCATCTTCTCCAGCACCGGCAGGCTCTATGATTATGCTAGCACTAGGTTAGATCTCTCTTTCTCTCACTCTCTCAAATATTGCATAATTTTATTTATTGACTTCAGTTTGTTGATGGATCTTGCTCCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

K-box SRF-TF

Protein Analysis

88

Amino Acids

9.97

Weight (kDa)

9.75

Isoelectric Point (pI)

35.82

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
SRF-TF	PF00319	10 - 57	1.5e-26	SRF-type transcription factor (DNA-binding and dimerisation domain)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008928)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g11353 FvH4_4g19210 FvH4_5g29232
malus_domestica	MD05G1049100.v1.1 MD05G1049400.v1.1 MD06G1163200.v1.1 MD09G1074000.v1.1 MD09G1075200.v1.1 MD10G1055900.v1.1 MD10G1306300.v1.1
prunus_persica	Prupe.1G531300_v2.0.a1 Prupe.1G531500_v2.0.a1 Prupe.1G538700_v2.0.a1
pyrus_communis	pycom08g16930 pycom09g00120 pycom15g27670
rosa_chinensis	RchiOBHm_Chr6g0270001 RchiOBHm_Chr7g0233561
rosa_multiflora	Rmu_sc0002409.1_g000001 Rmu_sc0008851.1_g000013
rosa_roxburghii	Rroxscaffold_3G00227180 Rroxscaffold_5G00351090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	16, 261
AcuI	CTGAAG	2 cut(s)	107, 223
AluBI	AGCT	1 cut(s)	103
AluI	AGCT	1 cut(s)	103
AlwI	GGATC	2 cut(s)	16, 261
ApeKI	GCWGC	1 cut(s)	82
AsuNHI	GCTAGC	1 cut(s)	173
BbvCI	CCTCAGC	1 cut(s)	123
BbvI	GCAGC	1 cut(s)	69
BccI	CCATC	1 cut(s)	244
BclI	TGATCA	1 cut(s)	135
BfaI	CTAG	2 cut(s)	174, 180
BglII	AGATCT	1 cut(s)	187
BisI	GCNGC	1 cut(s)	83
BlsI	GCNGC	1 cut(s)	84
BmsI	GCATC	1 cut(s)	109
BmtI	GCTAGC	1 cut(s)	177
BpmI	CTGGAG	1 cut(s)	130
Bpu10I	CCTNAGC	2 cut(s)	96, 123
BsaBI	GATNNNNATC	1 cut(s)	20
Bse118I	RCCGGY	1 cut(s)	152
Bse8I	GATNNNNATC	1 cut(s)	20
BseJI	GATNNNNATC	1 cut(s)	20
BseMII	CTCAG	1 cut(s)	114
BseXI	GCAGC	1 cut(s)	69
BsiSI	CCGG	1 cut(s)	153
Bsp143I	GATC	4 cut(s)	21, 135, 187, 253
BspCNI	CTCAG	1 cut(s)	115
BspOI	GCTAGC	1 cut(s)	177
BspPI	GGATC	2 cut(s)	16, 261
BsrFI	RCCGGY	1 cut(s)	152
BssAI	RCCGGY	1 cut(s)	152
BssMI	GATC	4 cut(s)	21, 135, 187, 253
BstC8I	GCNNGC	2 cut(s)	158, 175
BstDEI	CTNAG	2 cut(s)	96, 123
BstKTI	GATC	4 cut(s)	24, 138, 190, 256
BstMBI	GATC	4 cut(s)	21, 135, 187, 253
BstV1I	GCAGC	1 cut(s)	69
BstX2I	RGATCY	2 cut(s)	187, 253
BstYI	RGATCY	2 cut(s)	187, 253
Cac8I	GCNNGC	2 cut(s)	158, 175
Cfr10I	RCCGGY	1 cut(s)	152
CviJI	RGCY	4 cut(s)	82, 95, 103, 160
CviKI_1	RGCY	4 cut(s)	82, 95, 103, 160
DdeI	CTNAG	2 cut(s)	96, 123
DpnI	GATC	4 cut(s)	23, 137, 189, 255
DpnII	GATC	4 cut(s)	21, 135, 187, 253
Eco57I	CTGAAG	2 cut(s)	107, 223
FaiI	YATR	3 cut(s)	165, 171, 221
FbaI	TGATCA	1 cut(s)	135
Fnu4HI	GCNGC	1 cut(s)	83
Fsp4HI	GCNGC	1 cut(s)	83
FspBI	CTAG	2 cut(s)	174, 180
GluI	GCNGC	1 cut(s)	83
GsuI	CTGGAG	1 cut(s)	130
HapII	CCGG	1 cut(s)	153
HpaII	CCGG	1 cut(s)	153
Hpy188I	TCNGA	1 cut(s)	26
Hpy99I	CGWCG	1 cut(s)	46
HpyAV	CCTTC	2 cut(s)	21, 85
HpyCH4IV	ACGT	1 cut(s)	59
HpyCH4V	TGCA	1 cut(s)	219
HpyF3I	CTNAG	2 cut(s)	96, 123
HpySE526I	ACGT	1 cut(s)	59
Ksp22I	TGATCA	1 cut(s)	135
Kzo9I	GATC	4 cut(s)	21, 135, 187, 253
LmnI	GCTCC	2 cut(s)	100, 265
LpnPI	CCDG	3 cut(s)	142, 160, 166
Lsp1109I	GCAGC	1 cut(s)	69
LweI	GCATC	1 cut(s)	109
MaeI	CTAG	2 cut(s)	174, 180
MaeII	ACGT	1 cut(s)	59
MaeIII	GTNAC	1 cut(s)	55
MalI	GATC	4 cut(s)	23, 137, 189, 255
MboI	GATC	4 cut(s)	21, 135, 187, 253
MboII	GAAGA	3 cut(s)	84, 100, 133
MflI	RGATCY	2 cut(s)	187, 253
MluCI	AATT	2 cut(s)	37, 222
MmeI	TCCRAC	1 cut(s)	109
MnlI	CCTC	1 cut(s)	118
MseI	TTAA	1 cut(s)	265
MspI	CCGG	1 cut(s)	153
NdeII	GATC	4 cut(s)	21, 135, 187, 253
NheI	GCTAGC	1 cut(s)	173
NmuCI	GTSAC	1 cut(s)	55
PkrI	GCNGC	1 cut(s)	84
PsuI	RGATCY	2 cut(s)	187, 253
SaqAI	TTAA	1 cut(s)	265
SatI	GCNGC	1 cut(s)	83
Sau3AI	GATC	4 cut(s)	21, 135, 187, 253
SetI	ASST	4 cut(s)	62, 105, 129, 185
SfaNI	GCATC	1 cut(s)	109
SgeI	CNNG	9 cut(s)	25, 57, 65, 79, 159, 165, 169, 186, 192
Sse9I	AATT	2 cut(s)	37, 222
SspI	AATATT	1 cut(s)	215
SspMI	CTAG	2 cut(s)	174, 180
TaiI	ACGT	1 cut(s)	62
TaqI	TCGA	1 cut(s)	41
TasI	AATT	2 cut(s)	37, 222
Tru1I	TTAA	1 cut(s)	265
Tru9I	TTAA	1 cut(s)	265
TseFI	GTSAC	1 cut(s)	55
TseI	GCWGC	1 cut(s)	82
Tsp45I	GTSAC	1 cut(s)	55
XspI	CTAG	2 cut(s)	174, 180

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.