pycom08g16930

transcription regulatory region sequence-specific DNA binding

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Forward (+)
17053119 .. 17055124
2006 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g16930.2

Sequence Viewer

Length: 246 bp
ATGAAGAAAGCTGGAGAGCTGTCGATTCTGTGTGAATCTGAAGCTGCTGTTATCATCTTTTCCCAAACTGACAAGCTCCTTGATTTCTCAAGCTCCAGAGTGATCGAGCTGACCTCATTGCCTTGGTTGACGATGATGAACAACTGGAAGAGGGACATCATCCAGGTCGACTTGACTAAGATGTGGTCATCAGCACATGATAACCATGAACGAGAGGAGAGGATTCTAGTGCTGCAAGCATTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.41

Weight (kDa)

5.23

Isoelectric Point (pI)

46.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 60
AjnI CCWGG 1 cut(s) 162
AluBI AGCT 6 cut(s) 11, 19, 44, 76, 93, 109
AluI AGCT 6 cut(s) 11, 19, 44, 76, 93, 109
ApeKI GCWGC 2 cut(s) 44, 232
BbvI GCAGC 2 cut(s) 31, 219
BciT130I CCWGG 1 cut(s) 164
BfaI CTAG 2 cut(s) 227, 244
BisI GCNGC 2 cut(s) 45, 233
BlsI GCNGC 2 cut(s) 46, 234
Bme1390I CCNGG 1 cut(s) 164
BmrFI CCNGG 1 cut(s) 164
BplI GAGNNNNNCTC 2 cut(s) 98, 130
BpmI CTGGAG 2 cut(s) 33, 79
BpuEI CTTGAG 1 cut(s) 73
BsaJI CCNNGG 1 cut(s) 122
Bse1I ACTGG 1 cut(s) 149
Bse3DI GCAATG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 164
BseDI CCNNGG 1 cut(s) 122
BseGI GGATG 1 cut(s) 159
BseMI GCAATG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 149
BseRI GAGGAG 1 cut(s) 230
BseXI GCAGC 2 cut(s) 31, 219
BslFI GGGAC 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 167
BsmI GAATGC 1 cut(s) 239
Bsp143I GATC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 116
BsrI ACTGG 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 122
BssMI GATC 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 164
Bst6I CTCTTC 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 237
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 1 cut(s) 159
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 164
BstSCI CCNGG 1 cut(s) 162
BstV1I GCAGC 2 cut(s) 31, 219
BtsCI GGATG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 237
CviAII CATG 2 cut(s) 197, 206
CviJI RGCY 6 cut(s) 11, 19, 44, 76, 93, 109
CviKI_1 RGCY 6 cut(s) 11, 19, 44, 76, 93, 109
DdeI CTNAG 1 cut(s) 177
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 143
EarI CTCTTC 1 cut(s) 143
Eco130I CCWWGG 1 cut(s) 122
Eco57I CTGAAG 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 162
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaeI CATG 2 cut(s) 200, 209
FaiI YATR 2 cut(s) 198, 207
FaqI GGGAC 1 cut(s) 167
FatI CATG 2 cut(s) 196, 205
FblI GTMKAC 1 cut(s) 168
Fnu4HI GCNGC 2 cut(s) 45, 233
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 2 cut(s) 45, 233
FspBI CTAG 2 cut(s) 227, 244
GluI GCNGC 2 cut(s) 45, 233
GsuI CTGGAG 2 cut(s) 33, 79
Hin1II CATG 2 cut(s) 200, 209
HincII GTYRAC 2 cut(s) 129, 169
HindII GTYRAC 2 cut(s) 129, 169
HinfI GANTC 3 cut(s) 25, 35, 223
Hpy166II GTNNAC 2 cut(s) 129, 169
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 96
Hpy8I GTNNAC 2 cut(s) 129, 169
HpyCH4V TGCA 1 cut(s) 235
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 2 cut(s) 200, 209
Kzo9I GATC 1 cut(s) 102
LmnI GCTCC 2 cut(s) 81, 98
LpnPI CCDG 4 cut(s) 109, 130, 149, 176
Lsp1109I GCAGC 2 cut(s) 31, 219
MaeI CTAG 2 cut(s) 227, 244
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 2 cut(s) 16, 160
MnlI CCTC 4 cut(s) 124, 144, 208, 213
MspR9I CCNGG 1 cut(s) 164
Mva1269I GAATGC 1 cut(s) 239
MvaI CCWGG 1 cut(s) 164
NdeII GATC 1 cut(s) 102
NlaIII CATG 2 cut(s) 200, 209
PctI GAATGC 1 cut(s) 239
PfeI GAWTC 3 cut(s) 25, 35, 223
PkrI GCNGC 2 cut(s) 46, 234
Psp6I CCWGG 1 cut(s) 162
PspGI CCWGG 1 cut(s) 162
SalI GTCGAC 1 cut(s) 167
SatI GCNGC 2 cut(s) 45, 233
Sau3AI GATC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 164
SetI ASST 8 cut(s) 13, 21, 46, 78, 95, 111, 116, 168
SmlI CTYRAG 1 cut(s) 88
SmoI CTYRAG 1 cut(s) 88
SspMI CTAG 2 cut(s) 227, 244
StyD4I CCNGG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 122
TaqI TCGA 3 cut(s) 23, 105, 168
TfiI GAWTC 3 cut(s) 25, 35, 223
TseI GCWGC 2 cut(s) 44, 232
TspDTI ATGAA 3 cut(s) 17, 152, 222
XmiI GTMKAC 1 cut(s) 168
XspI CTAG 2 cut(s) 227, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.