Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr05

Orthogroup ID

OG0006905

Physical Location & Seq

Genomic Coordinates Forward (+)

43156220 .. 43157572

Gene Structure 1353 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD05G1297900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1353 bp

ATGTCCAAGATCATAGCAATTTCTCTTACTGGAAATCAACTCTCAGGCAGCCTTCCTGCAAACATAGGTATTGGGGTGCCAGACCTACAAAAGTTTTTTGTAGCAGACAATCAACTCAGTGGACCATTTCCCAACTTCATGTCCAATGGTTCTAAGCTTGCAAGGCTAGATATGTCCACGAACTCATTTTATGGGTTTATTCCAACCAAGCTCTGTCTCTTGAAAACCCTTGAGTATCTTAGCTTAAGCAAAAATAATTTGGCGATTAATACTTCAACTCCAGAACTAAACATCCTTTCTTGTTTCGCTAATCTTACAAATCTTTGGGGGTTCCTTTTATCGGAAAATCCATTAAACATCACTCTTCCGGTTTCCTTTGGAAATCTCTCTACATCGCTTGAATATCTTGATATAAGCAATTGCAACTTGAGGGGCAACATTCCAAGTGATATTGGAAATATGAGCAAGCTGACATCCTTAGACTTGGGATACAATGAATTGAGTGGGTCAATTCCAACTTCTGTGGGAAGATTAGGGAATCTTCAAGGTTTGTATTTGAACGATAACAAGTTGCAAGGATACATCCCATATGAACTCGACAATCTAGCTGAATTACTTTTGGGTGGTAATCAACTCTCTGGTTCTGTACCTTCCTGCTTAGGTAATCTAGTTGCAACTCTAAGAACTCTATCATTAGCTTCCAATTTGTTAAGTTCCACAATACCACCTTCCTTGTGGCAACTCACATATATCTTGCACCTCAACTTGTCAACCAATTCTCTATCTGGACCTCTCTCAGAAAGTATTGGAAAACTTACAGTTGCAACAGATATGGATTTATCAAATAACCAATTATCTGGTGCTCTACCAAATAGTATTGGTGGACTCCAGGATTTGGTTAGTCTTTCATTAAAAGATAATAATTTAGATGGCCACATTCCCAGTTCATTTGGCAACATGCTAAGCCTGGAATTCTTGGATCTGTCCAAAAATAATCTGTCGGGAGTGATTCCAAAGTCTCTAGAAACACTGTTACATCTCAAGTATCTAAATTTATCTATCAACATACTCCAAGGAGAAATTCCAACAGGTGGTCCTTTCAAAAACTTCTCTGCTCAATCATTTACATCAAATGCTGCACTTTGTGGTGCACCGCGACTCCATGTTCAACCATGCACAAACAGTACAGAGAAACCAAATTCAAAGAAGGCTAGAAAATCTATCGTGAAGTATATTGTTCCAGGGATATTGTCAGCAATGCTCCTAGGGACCTTTATAGCGTTACTAATAGTGCGCATGATAAGGAATAATGTGGAAGTTGCAACAGATACTATCTTGTTGCCTGACCTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04016 ko04626 map04016 map04626

Pfam Domains

Protein Families

LRRNT_2 LRR_1 LRR_8

Protein Analysis

451

Amino Acids

48.22

Weight (kDa)

6.11

Isoelectric Point (pI)

33.6

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LRR_8	PF13855	132 - 191	5.3e-07	Leucine rich repeat
LRR_14	PF23598	132 - 205	1.4e-06	Leucine-rich repeat region
LRR_14	PF23598	227 - 354	1.8e-08	Leucine-rich repeat region
LRR_8	PF13855	299 - 355	9e-07	Leucine rich repeat

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006905)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g13800 FvH4_3g07542
malus_domestica	MD03G1281200.v1.1 MD05G1297900.v1.1 MD10G1277300.v1.1
pyrus_communis	pycom03g13590 pycom03g13600 pycom03g13630
rosa_chinensis	RchiOBHm_Chr5g0010951 RchiOBHm_Chr5g0011281 RchiOBHm_Chr5g0011351
rosa_multiflora	Rmu_co8418559.1_g000001 Rmu_sc0000299.1_g000022 Rmu_sc0001878.1_g000001 Rmu_sc0004283.1_g000034 Rmu_ssc0000400.1_g000090
rosa_roxburghii	Rroxscaffold_1G00040170 Rroxscaffold_1G00040240 Rroxscaffold_1G00040270 Rroxscaffold_1G00040890 Rroxscaffold_1G00065140
rosa_rugosa	Rorug02G0188900 Rorug06G0110500
rosa_samantha	Rh5BG083200 Rh5BG288500
rosa_wichuraiana	Rw6G015370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	1295
AccB1I	GGYRCC	1 cut(s)	76
AccB7I	CCANNNNNTGG	2 cut(s)	895, 1091
AccII	CGCG	1 cut(s)	1156
AciI	CCGC	1 cut(s)	1154
AclWI	GGATC	1 cut(s)	987
AcoI	YGGCCR	1 cut(s)	931
AcsI	RAATTY	4 cut(s)	971, 1051, 1080, 1198
AdeI	CACNNNGTG	1 cut(s)	1145
AfaI	GTAC	2 cut(s)	648, 1186
AfiI	CCNNNNNNNGG	3 cut(s)	340, 895, 1091
AflII	CTTAAG	1 cut(s)	244
AgsI	TTSAA	8 cut(s)	223, 276, 401, 545, 559, 1102, 1169, 1203
AjnI	CCWGG	3 cut(s)	888, 966, 1240
AjuI	GAANNNNNNNTTGG	2 cut(s)	1065, 1097
AloI	GAACNNNNNNTCC	2 cut(s)	276, 308
AluBI	AGCT	6 cut(s)	157, 211, 243, 469, 608, 698
AluI	AGCT	6 cut(s)	157, 211, 243, 469, 608, 698
Alw21I	GWGCWC	2 cut(s)	865, 1153
Alw26I	GTCTC	2 cut(s)	221, 1023
Alw44I	GTGCAC	1 cut(s)	1149
AlwI	GGATC	1 cut(s)	987
AoxI	GGCC	1 cut(s)	931
ApaLI	GTGCAC	1 cut(s)	1149
ApeKI	GCWGC	2 cut(s)	48, 1136
ApoI	RAATTY	4 cut(s)	971, 1051, 1080, 1198
AseI	ATTAAT	1 cut(s)	267
AspA2I	CCTAGG	1 cut(s)	1264
AspLEI	GCGC	1 cut(s)	1296
AspS9I	GGNCC	4 cut(s)	122, 788, 1094, 1269
AvaII	GGWCC	4 cut(s)	122, 788, 1094, 1269
AvrII	CCTAGG	1 cut(s)	1264
BaeGI	GKGCMC	1 cut(s)	1153
BalI	TGGCCA	1 cut(s)	933
BanI	GGYRCC	1 cut(s)	76
Bbv12I	GWGCWC	2 cut(s)	865, 1153
BbvI	GCAGC	2 cut(s)	60, 1123
BccI	CCATC	1 cut(s)	923
BciT130I	CCWGG	3 cut(s)	890, 968, 1242
BciVI	GTATCC	2 cut(s)	482, 572
BcoDI	GTCTC	2 cut(s)	221, 1023
BfaI	CTAG	6 cut(s)	167, 605, 668, 1022, 1212, 1265
BfmI	CTRYAG	1 cut(s)	1349
BfrI	CTTAAG	1 cut(s)	244
BfuI	GTATCC	2 cut(s)	482, 572
BisI	GCNGC	2 cut(s)	49, 1137
BlnI	CCTAGG	1 cut(s)	1264
BlpI	GCTNAGC	1 cut(s)	962
BlsI	GCNGC	2 cut(s)	50, 1138
Bme1390I	CCNGG	3 cut(s)	890, 968, 1242
Bme18I	GGWCC	4 cut(s)	122, 788, 1094, 1269
BmgT120I	GGNCC	4 cut(s)	122, 788, 1094, 1269
BmiI	GGNNCC	3 cut(s)	78, 332, 1270
BmrFI	CCNGG	3 cut(s)	890, 968, 1242
BmrI	ACTGGG	1 cut(s)	936
BmuI	ACTGGG	1 cut(s)	936
BpmI	CTGGAG	2 cut(s)	264, 872
Bpu10I	CCTNAGC	1 cut(s)	658
Bpu1102I	GCTNAGC	1 cut(s)	962
BpuEI	CTTGAG	3 cut(s)	251, 448, 1025
BsaJI	CCNNGG	3 cut(s)	1072, 1241, 1264
BsaWI	WCCGGW	1 cut(s)	367
BsaXI	ACNNNNNCTCC	4 cut(s)	262, 292, 1143, 1173
Bsc4I	CCNNNNNNNGG	3 cut(s)	340, 895, 1091
Bse1I	ACTGG	2 cut(s)	34, 942
Bse3DI	GCAATG	1 cut(s)	1263
BseBI	CCWGG	3 cut(s)	890, 968, 1242
BseDI	CCNNGG	3 cut(s)	1072, 1241, 1264
BseGI	GGATG	3 cut(s)	291, 473, 582
BseLI	CCNNNNNNNGG	3 cut(s)	340, 895, 1091
BseMI	GCAATG	1 cut(s)	1263
BseMII	CTCAG	3 cut(s)	57, 130, 810
BseNI	ACTGG	2 cut(s)	34, 942
BseSI	GKGCMC	1 cut(s)	1153
BseXI	GCAGC	2 cut(s)	60, 1123
BsgI	GTGCAG	1 cut(s)	1122
Bsh1236I	CGCG	1 cut(s)	1156
BshFI	GGCC	1 cut(s)	933
BshNI	GGYRCC	1 cut(s)	76
BsiHKAI	GWGCWC	2 cut(s)	865, 1153
BsiSI	CCGG	1 cut(s)	368
BslFI	GGGAC	1 cut(s)	1282
BslI	CCNNNNNNNGG	3 cut(s)	340, 895, 1091
BsmAI	GTCTC	2 cut(s)	221, 1023
BsmFI	GGGAC	1 cut(s)	1282
BsnI	GGCC	1 cut(s)	933
Bsp1286I	GDGCHC	2 cut(s)	865, 1153
Bsp143I	GATC	2 cut(s)	9, 979
Bsp1720I	GCTNAGC	1 cut(s)	962
BspACI	CCGC	1 cut(s)	1154
BspANI	GGCC	1 cut(s)	933
BspCNI	CTCAG	3 cut(s)	56, 129, 809
BspFNI	CGCG	1 cut(s)	1156
BspLI	GGNNCC	3 cut(s)	78, 332, 1270
BspPI	GGATC	1 cut(s)	987
BspT107I	GGYRCC	1 cut(s)	76
BspTI	CTTAAG	1 cut(s)	244
BsrDI	GCAATG	1 cut(s)	1263
BsrI	ACTGG	2 cut(s)	34, 942
BssECI	CCNNGG	3 cut(s)	1072, 1241, 1264
BssMI	GATC	2 cut(s)	9, 979
BssT1I	CCWWGG	2 cut(s)	1072, 1264
Bst2UI	CCWGG	3 cut(s)	890, 968, 1242
Bst4CI	ACNGT	3 cut(s)	820, 1032, 1184
Bst6I	CTCTTC	1 cut(s)	369
BstAFI	CTTAAG	1 cut(s)	244
BstC8I	GCNNGC	2 cut(s)	159, 467
BstDEI	CTNAG	9 cut(s)	43, 116, 153, 239, 478, 658, 680, 796, 962
BstF5I	GGATG	3 cut(s)	291, 473, 582
BstFNI	CGCG	1 cut(s)	1156
BstHHI	GCGC	1 cut(s)	1296
BstKTI	GATC	2 cut(s)	12, 982
BstMAI	GTCTC	2 cut(s)	221, 1023
BstMBI	GATC	2 cut(s)	9, 979
BstMWI	GCNNNNNNNGC	1 cut(s)	163
BstNI	CCWGG	3 cut(s)	890, 968, 1242
BstNSI	RCATGY	1 cut(s)	961
BstSCI	CCNGG	3 cut(s)	888, 966, 1240
BstSFI	CTRYAG	1 cut(s)	1349
BstSLI	GKGCMC	1 cut(s)	1153
BstUI	CGCG	1 cut(s)	1156
BstV1I	GCAGC	2 cut(s)	60, 1123
BstX2I	RGATCY	1 cut(s)	979
BstXI	CCANNNNNNTGG	1 cut(s)	857
BstYI	RGATCY	1 cut(s)	979
BsuI	GTATCC	2 cut(s)	482, 572
BsuRI	GGCC	1 cut(s)	933
BtgZI	GCGATG	1 cut(s)	378
BtsCI	GGATG	3 cut(s)	291, 473, 582
BtsIMutI	CAGTG	2 cut(s)	124, 1028
Cac8I	GCNNGC	2 cut(s)	159, 467
CfoI	GCGC	1 cut(s)	1296
Cfr13I	GGNCC	4 cut(s)	122, 788, 1094, 1269
Csp6I	GTAC	2 cut(s)	647, 1185
CspCI	CAANNNNNGTGG	4 cut(s)	504, 539, 714, 749
CviAII	CATG	5 cut(s)	139, 958, 1163, 1173, 1297
CviQI	GTAC	2 cut(s)	647, 1185
DdeI	CTNAG	9 cut(s)	43, 116, 153, 239, 478, 658, 680, 796, 962
DpnI	GATC	2 cut(s)	11, 981
DpnII	GATC	2 cut(s)	9, 979
DraIII	CACNNNGTG	1 cut(s)	1145
EaeI	YGGCCR	1 cut(s)	931
Eam1104I	CTCTTC	1 cut(s)	369
EarI	CTCTTC	1 cut(s)	369
Eco130I	CCWWGG	2 cut(s)	1072, 1264
Eco47I	GGWCC	4 cut(s)	122, 788, 1094, 1269
EcoO109I	RGGNCCY	1 cut(s)	1269
EcoRI	GAATTC	1 cut(s)	971
EcoRII	CCWGG	3 cut(s)	888, 966, 1240
EcoT14I	CCWWGG	2 cut(s)	1072, 1264
ErhI	CCWWGG	2 cut(s)	1072, 1264
FaeI	CATG	5 cut(s)	142, 961, 1166, 1176, 1300
FaqI	GGGAC	1 cut(s)	1282
FatI	CATG	5 cut(s)	138, 957, 1162, 1172, 1296
FauNDI	CATATG	1 cut(s)	589
Fnu4HI	GCNGC	2 cut(s)	49, 1137
FokI	GGATG	3 cut(s)	278, 460, 569
Fsp4HI	GCNGC	2 cut(s)	49, 1137
FspAI	RTGCGCAY	1 cut(s)	1295
FspBI	CTAG	6 cut(s)	167, 605, 668, 1022, 1212, 1265
FspI	TGCGCA	1 cut(s)	1295
GlaI	GCGC	1 cut(s)	1295
GluI	GCNGC	2 cut(s)	49, 1137
GsuI	CTGGAG	2 cut(s)	264, 872
HaeIII	GGCC	1 cut(s)	933
HapII	CCGG	1 cut(s)	368
HhaI	GCGC	1 cut(s)	1296
Hin1II	CATG	5 cut(s)	142, 961, 1166, 1176, 1300
Hin6I	GCGC	1 cut(s)	1294
HinP1I	GCGC	1 cut(s)	1294
HincII	GTYRAC	1 cut(s)	771
HindII	GTYRAC	1 cut(s)	771
HindIII	AAGCTT	1 cut(s)	155
HinfI	GANTC	4 cut(s)	538, 885, 1009, 1158
HpaII	CCGG	1 cut(s)	368
Hpy166II	GTNNAC	5 cut(s)	122, 177, 771, 884, 1151
Hpy188I	TCNGA	2 cut(s)	343, 799
Hpy188III	TCNNGA	7 cut(s)	220, 281, 407, 786, 1002, 1022, 1225
Hpy8I	GTNNAC	5 cut(s)	122, 177, 771, 884, 1151
HpyAV	CCTTC	4 cut(s)	62, 660, 738, 1201
HpyCH4III	ACNGT	3 cut(s)	820, 1032, 1184
HpyF10VI	GCNNNNNNNGC	1 cut(s)	163
HpyF3I	CTNAG	9 cut(s)	43, 116, 153, 239, 478, 658, 680, 796, 962
Hsp92II	CATG	5 cut(s)	142, 961, 1166, 1176, 1300
HspAI	GCGC	1 cut(s)	1294
Kzo9I	GATC	2 cut(s)	9, 979
LmnI	GCTCC	1 cut(s)	1266
Lsp1109I	GCAGC	2 cut(s)	60, 1123
MaeI	CTAG	6 cut(s)	167, 605, 668, 1022, 1212, 1265
MaeIII	GTNAC	2 cut(s)	1032, 1281
MalI	GATC	2 cut(s)	11, 981
MboI	GATC	2 cut(s)	9, 979
MboII	GAAGA	3 cut(s)	356, 533, 540
MfeI	CAATTG	1 cut(s)	418
MflI	RGATCY	1 cut(s)	979
MhlI	GDGCHC	2 cut(s)	865, 1153
MlsI	TGGCCA	1 cut(s)	933
MluNI	TGGCCA	1 cut(s)	933
MlyI	GAGTC	2 cut(s)	879, 1152
MmeI	TCCRAC	3 cut(s)	227, 539, 1109
MnlI	CCTC	3 cut(s)	423, 770, 801
Mox20I	TGGCCA	1 cut(s)	933
MscI	TGGCCA	1 cut(s)	933
MseI	TTAA	5 cut(s)	245, 267, 353, 710, 911
Msp20I	TGGCCA	1 cut(s)	933
MspCI	CTTAAG	1 cut(s)	244
MspI	CCGG	1 cut(s)	368
MspR9I	CCNGG	3 cut(s)	890, 968, 1242
MunI	CAATTG	1 cut(s)	418
MvaI	CCWGG	3 cut(s)	890, 968, 1242
MvnI	CGCG	1 cut(s)	1156
MwoI	GCNNNNNNNGC	1 cut(s)	163
NdeI	CATATG	1 cut(s)	589
NdeII	GATC	2 cut(s)	9, 979
NlaIII	CATG	5 cut(s)	142, 961, 1166, 1176, 1300
NlaIV	GGNNCC	3 cut(s)	78, 332, 1270
NsbI	TGCGCA	1 cut(s)	1295
NspI	RCATGY	1 cut(s)	961
PfeI	GAWTC	2 cut(s)	538, 1009
PflMI	CCANNNNNTGG	2 cut(s)	895, 1091
PfoI	TCCNGGA	1 cut(s)	888
PkrI	GCNGC	2 cut(s)	50, 1138
PleI	GAGTC	2 cut(s)	879, 1152
PpsI	GAGTC	2 cut(s)	879, 1152
PpuMI	RGGWCCY	1 cut(s)	1269
PshBI	ATTAAT	1 cut(s)	267
Psp5II	RGGWCCY	1 cut(s)	1269
Psp6I	CCWGG	3 cut(s)	888, 966, 1240
PspGI	CCWGG	3 cut(s)	888, 966, 1240
PspN4I	GGNNCC	3 cut(s)	78, 332, 1270
PspPI	GGNCC	4 cut(s)	122, 788, 1094, 1269
PspPPI	RGGWCCY	1 cut(s)	1269
PsuI	RGATCY	1 cut(s)	979
RsaI	GTAC	2 cut(s)	648, 1186
RsaNI	GTAC	2 cut(s)	647, 1185
SaqAI	TTAA	5 cut(s)	245, 267, 353, 710, 911
SatI	GCNGC	2 cut(s)	49, 1137
Sau3AI	GATC	2 cut(s)	9, 979
Sau96I	GGNCC	4 cut(s)	122, 788, 1094, 1269
SchI	GAGTC	2 cut(s)	879, 1152
ScrFI	CCNGG	3 cut(s)	890, 968, 1242
SduI	GDGCHC	2 cut(s)	865, 1153
SfcI	CTRYAG	1 cut(s)	1349
SinI	GGWCC	4 cut(s)	122, 788, 1094, 1269
SmlI	CTYRAG	4 cut(s)	230, 244, 427, 1040
SmoI	CTYRAG	4 cut(s)	230, 244, 427, 1040
SsiI	CCGC	1 cut(s)	1154
SspMI	CTAG	6 cut(s)	167, 605, 668, 1022, 1212, 1265
StyD4I	CCNGG	3 cut(s)	888, 966, 1240
StyI	CCWWGG	2 cut(s)	1072, 1264
TaaI	ACNGT	3 cut(s)	820, 1032, 1184
TaqI	TCGA	1 cut(s)	597
TatI	WGTACW	1 cut(s)	1184
TfiI	GAWTC	2 cut(s)	538, 1009
Tru1I	TTAA	5 cut(s)	245, 267, 353, 710, 911
Tru9I	TTAA	5 cut(s)	245, 267, 353, 710, 911
TscAI	CASTG	2 cut(s)	124, 1035
TseI	GCWGC	2 cut(s)	48, 1136
TspDTI	ATGAA	5 cut(s)	127, 510, 606, 897, 936
TspRI	CASTG	2 cut(s)	124, 1035
Van91I	CCANNNNNTGG	2 cut(s)	895, 1091
Vha464I	CTTAAG	1 cut(s)	244
VneI	GTGCAC	1 cut(s)	1149
VpaK11BI	GGWCC	4 cut(s)	122, 788, 1094, 1269
VspI	ATTAAT	1 cut(s)	267
XapI	RAATTY	4 cut(s)	971, 1051, 1080, 1198
XbaI	TCTAGA	1 cut(s)	1021
XceI	RCATGY	1 cut(s)	961
XcmI	CCANNNNNNNNNTGG	1 cut(s)	732
XmaJI	CCTAGG	1 cut(s)	1264
XspI	CTAG	6 cut(s)	167, 605, 668, 1022, 1212, 1265

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.