MD07G1165000.v1.1
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
23985970 .. 23986179
210 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1165000.v1.1.491

Sequence Viewer

Length: 210 bp
ATGTTGGAGCTACAATCCCTGAAACTTGGAGGCTCTATATCACCACATGTTGGAAACTTGAGTTTTATCAGAGTGTATAGTCTCTTAAACAACAACTTCCGCCATGGAATCCCTCCAGAAATTGGCCGTCTGCGCAAGCTGCAAACTTTGGTATTGCACAATAATTCACCGAATGGGGAAATTCCAGCTAATTTATCAAGTTTAGCCTAA

Protein Analysis

70

Amino Acids

7.56

Weight (kDa)

10.26

Isoelectric Point (pI)

49.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 134
AccB7I CCANNNNNTGG 2 cut(s) 50, 122
AciI CCGC 1 cut(s) 100
AcoI YGGCCR 1 cut(s) 124
AcsI RAATTY 1 cut(s) 180
AfiI CCNNNNNNNGG 2 cut(s) 50, 122
AflIII ACRYGT 1 cut(s) 46
AluBI AGCT 3 cut(s) 10, 139, 188
AluI AGCT 3 cut(s) 10, 139, 188
Alw26I GTCTC 1 cut(s) 86
AoxI GGCC 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 139
ApoI RAATTY 1 cut(s) 180
AspLEI GCGC 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 33, 159
BbvI GCAGC 1 cut(s) 126
BceAI ACGGC 1 cut(s) 111
BcoDI GTCTC 1 cut(s) 86
BisI GCNGC 1 cut(s) 140
BlsI GCNGC 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 99
BpuEI CTTGAG 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 2 cut(s) 50, 122
BseDI CCNNGG 1 cut(s) 103
BseLI CCNNNNNNNGG 2 cut(s) 50, 122
BseXI GCAGC 1 cut(s) 126
BshFI GGCC 1 cut(s) 126
BslI CCNNNNNNNGG 2 cut(s) 50, 122
BsmAI GTCTC 1 cut(s) 86
BsnI GGCC 1 cut(s) 126
Bsp19I CCATGG 1 cut(s) 103
BspACI CCGC 1 cut(s) 100
BspANI GGCC 1 cut(s) 126
BssECI CCNNGG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 103
BstC8I GCNNGC 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 103
BstHHI GCGC 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 86
BstMWI GCNNNNNNNGC 2 cut(s) 132, 139
BstNSI RCATGY 1 cut(s) 50
BstV1I GCAGC 1 cut(s) 126
BsuRI GGCC 1 cut(s) 126
BtgI CCRYGG 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 137
CfoI GCGC 1 cut(s) 135
CviAII CATG 2 cut(s) 47, 104
CviJI RGCY 6 cut(s) 10, 33, 126, 139, 188, 206
CviKI_1 RGCY 6 cut(s) 10, 33, 126, 139, 188, 206
EaeI YGGCCR 1 cut(s) 124
EciI GGCGGA 1 cut(s) 89
Eco130I CCWWGG 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 2 cut(s) 50, 107
FaiI YATR 4 cut(s) 38, 48, 78, 105
FatI CATG 2 cut(s) 46, 103
Fnu4HI GCNGC 1 cut(s) 140
Fsp4HI GCNGC 1 cut(s) 140
FspI TGCGCA 1 cut(s) 134
GlaI GCGC 1 cut(s) 134
GluI GCNGC 1 cut(s) 140
GsuI CTGGAG 1 cut(s) 99
HaeIII GGCC 1 cut(s) 126
HhaI GCGC 1 cut(s) 135
Hin1II CATG 2 cut(s) 50, 107
Hin6I GCGC 1 cut(s) 133
HinP1I GCGC 1 cut(s) 133
HinfI GANTC 1 cut(s) 108
HphI GGTGA 2 cut(s) 33, 159
Hpy188I TCNGA 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 142, 157
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 139
Hsp92II CATG 2 cut(s) 50, 107
HspAI GCGC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 3 cut(s) 32, 129, 198
Lsp1109I GCAGC 1 cut(s) 126
MluCI AATT 4 cut(s) 120, 163, 180, 190
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 2 cut(s) 23, 123
MseI TTAA 1 cut(s) 86
MwoI GCNNNNNNNGC 2 cut(s) 132, 139
NcoI CCATGG 1 cut(s) 103
NlaIII CATG 2 cut(s) 50, 107
NsbI TGCGCA 1 cut(s) 134
NspI RCATGY 1 cut(s) 50
PciI ACATGT 1 cut(s) 46
PfeI GAWTC 1 cut(s) 108
PflMI CCANNNNNTGG 2 cut(s) 50, 122
PkrI GCNGC 1 cut(s) 141
PscI ACATGT 1 cut(s) 46
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 1 cut(s) 140
SetI ASST 3 cut(s) 12, 141, 190
SgeI CNNG 8 cut(s) 31, 38, 59, 70, 116, 128, 148, 197
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 4 cut(s) 120, 163, 180, 190
SsiI CCGC 1 cut(s) 100
StyI CCWWGG 1 cut(s) 103
TasI AATT 4 cut(s) 120, 163, 180, 190
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TseI GCWGC 1 cut(s) 139
Van91I CCANNNNNTGG 2 cut(s) 50, 122
XapI RAATTY 1 cut(s) 180
XceI RCATGY 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.