MD13G1275400.v1.1

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0008883
Physical Location & Seq
Reverse (-)
37629730 .. 37630050
321 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1275400.v1.1.491

Sequence Viewer

Length: 321 bp
ATGTGTAACCATTACACCAAAAGAGTCTTGATGTTGAACCTGCATGATAAAAATTTGGCAGGCTCTTTACCTCCTTCTATAGGAAATCTTTCCTATCTTACTAGAATCAACCTAGTAAGCAACTTTTGTGGTGAAATTTCTGAAGAAATTGGTCGTCTGCAAAGCTTGCATGCTTTCAACTTGTCTCAGAATTCCTTCAATGGGAAAATTCCAACCAATTTATCCCAGTGTACACAACTAAAGATGATTGATTTTTGTTACAACGAGCTTATTGGGTCAATTCCAAACCAACTCAGTTCATTGTTGAAATTAAAGGCTTGA

Protein Analysis

107

Amino Acids

11.84

Weight (kDa)

8.78

Isoelectric Point (pI)

34.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 8 - 104 1.4e-06 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 48
AcsI RAATTY 4 cut(s) 52, 135, 190, 207
AcuI CTGAAG 1 cut(s) 162
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 2 cut(s) 80, 201
AgsI TTSAA 4 cut(s) 37, 178, 199, 307
AluBI AGCT 2 cut(s) 165, 268
AluI AGCT 2 cut(s) 165, 268
Alw26I GTCTC 1 cut(s) 189
ApoI RAATTY 4 cut(s) 52, 135, 190, 207
Asp700I GAANNNNTTC 2 cut(s) 88, 194
AsuHPI GGTGA 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 189
BfaI CTAG 2 cut(s) 102, 113
BfmI CTRYAG 1 cut(s) 78
BfuAI ACCTGC 1 cut(s) 48
BmrI ACTGGG 1 cut(s) 220
BmuI ACTGGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 80, 201
Bse1I ACTGG 1 cut(s) 226
BseLI CCNNNNNNNGG 2 cut(s) 80, 201
BseMII CTCAG 2 cut(s) 200, 307
BseNI ACTGG 1 cut(s) 226
BslI CCNNNNNNNGG 2 cut(s) 80, 201
BsmAI GTCTC 1 cut(s) 189
Bsp1407I TGTACA 1 cut(s) 230
BspCNI CTCAG 2 cut(s) 199, 306
BspMI ACCTGC 1 cut(s) 48
BsrGI TGTACA 1 cut(s) 230
BsrI ACTGG 1 cut(s) 226
BstAPI GCANNNNNTGC 1 cut(s) 166
BstAUI TGTACA 1 cut(s) 230
BstC8I GCNNGC 3 cut(s) 61, 167, 171
BstDEI CTNAG 2 cut(s) 186, 293
BstENI CCTNNNNNAGG 1 cut(s) 78
BstMAI GTCTC 1 cut(s) 189
BstMWI GCNNNNNNNGC 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 173
BstSFI CTRYAG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 233
BveI ACCTGC 1 cut(s) 48
Cac8I GCNNGC 3 cut(s) 61, 167, 171
Csp6I GTAC 1 cut(s) 231
CspCI CAANNNNNGTGG 2 cut(s) 109, 144
CviAII CATG 2 cut(s) 44, 170
CviJI RGCY 4 cut(s) 63, 165, 268, 317
CviKI_1 RGCY 4 cut(s) 63, 165, 268, 317
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 2 cut(s) 186, 293
Eco57I CTGAAG 1 cut(s) 162
EcoNI CCTNNNNNAGG 1 cut(s) 78
EcoRI GAATTC 1 cut(s) 190
FaeI CATG 2 cut(s) 47, 173
FaiI YATR 3 cut(s) 45, 80, 171
FatI CATG 2 cut(s) 43, 169
FspBI CTAG 2 cut(s) 102, 113
Hin1II CATG 2 cut(s) 47, 173
HindIII AAGCTT 1 cut(s) 163
HinfI GANTC 2 cut(s) 24, 105
HphI GGTGA 1 cut(s) 143
Hpy166II GTNNAC 2 cut(s) 231, 233
Hpy188I TCNGA 2 cut(s) 142, 189
Hpy188III TCNNGA 1 cut(s) 28
Hpy8I GTNNAC 2 cut(s) 231, 233
HpyAV CCTTC 2 cut(s) 84, 205
HpyCH4V TGCA 3 cut(s) 43, 160, 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 166
HpyF3I CTNAG 2 cut(s) 186, 293
Hsp92II CATG 2 cut(s) 47, 173
LpnPI CCDG 3 cut(s) 45, 53, 239
MaeI CTAG 2 cut(s) 102, 113
MaeIII GTNAC 2 cut(s) 5, 257
MboII GAAGA 1 cut(s) 155
MluCI AATT 8 cut(s) 52, 135, 147, 190, 207, 217, 279, 308
MlyI GAGTC 1 cut(s) 33
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 1 cut(s) 81
MroXI GAANNNNTTC 2 cut(s) 88, 194
MseI TTAA 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 166
NlaIII CATG 2 cut(s) 47, 173
NspI RCATGY 1 cut(s) 173
PaeI GCATGC 1 cut(s) 173
PdmI GAANNNNTTC 2 cut(s) 88, 194
PfeI GAWTC 1 cut(s) 105
PleI GAGTC 1 cut(s) 32
PpsI GAGTC 1 cut(s) 32
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
SaqAI TTAA 1 cut(s) 311
SchI GAGTC 1 cut(s) 33
SetI ASST 5 cut(s) 42, 73, 114, 167, 270
SfcI CTRYAG 1 cut(s) 78
SphI GCATGC 1 cut(s) 173
Sse9I AATT 8 cut(s) 52, 135, 147, 190, 207, 217, 279, 308
SspMI CTAG 2 cut(s) 102, 113
TasI AATT 8 cut(s) 52, 135, 147, 190, 207, 217, 279, 308
TatI WGTACW 1 cut(s) 230
TfiI GAWTC 1 cut(s) 105
Tru1I TTAA 1 cut(s) 311
Tru9I TTAA 1 cut(s) 311
TscAI CASTG 1 cut(s) 233
TspDTI ATGAA 1 cut(s) 288
TspRI CASTG 1 cut(s) 233
XagI CCTNNNNNAGG 1 cut(s) 78
XapI RAATTY 4 cut(s) 52, 135, 190, 207
XceI RCATGY 1 cut(s) 173
XmnI GAANNNNTTC 2 cut(s) 88, 194
XspI CTAG 2 cut(s) 102, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.