MD07G1255500.v1.1

21 kDa protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0004281
Physical Location & Seq
Reverse (-)
32262659 .. 32263009
351 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1255500.v1.1.491

Sequence Viewer

Length: 351 bp
ATGTCCTCTATCATGATGTTGAAACTCTCCCAAAGCCATGGCATGAAGCCTAGAGAAGTCGGAGCCATGAGGGACTGCATCGAAGAGTTCAGTGATTCGGTTGATGCGATTCAAAGGTCCATAGCTGAGATGGGCAACTTTAGGAGCTCGGAATTTCAGCTCATGATAAGTGATGTGCAAACCTGGGTTAGTGCTGCTTTGACAGATGAGACCACTTGCTCTGATGGGTTTGGCGGAAATTTGATGAATGGCAATTTGAAGACTGTCGTGAGGGGCATAATTGTGAACATCGCACAATTGACTTGCAATTCCTTGGCTTTGGTCAACAGATACGCCTCAGTTCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

117

Amino Acids

12.64

Weight (kDa)

5.21

Isoelectric Point (pI)

28.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 8 - 107 4.6e-22 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 234
AcsI RAATTY 2 cut(s) 152, 238
AgsI TTSAA 3 cut(s) 22, 113, 259
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 3 cut(s) 125, 147, 160
AluI AGCT 3 cut(s) 125, 147, 160
Alw21I GWGCWC 1 cut(s) 149
Alw26I GTCTC 1 cut(s) 203
ApeKI GCWGC 1 cut(s) 194
ApoI RAATTY 2 cut(s) 152, 238
AspS9I GGNCC 1 cut(s) 117
AvaII GGWCC 1 cut(s) 117
BanII GRGCYC 1 cut(s) 149
BbsI GAAGAC 1 cut(s) 266
Bbv12I GWGCWC 1 cut(s) 149
BbvI GCAGC 1 cut(s) 181
BccI CCATC 2 cut(s) 124, 218
BciT130I CCWGG 1 cut(s) 184
BcoDI GTCTC 1 cut(s) 203
BfaI CTAG 1 cut(s) 51
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 184
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 64
BmrFI CCNGG 1 cut(s) 184
BmsI GCATC 2 cut(s) 87, 94
BpiI GAAGAC 1 cut(s) 266
BsaI GGTCTC 1 cut(s) 203
BsaJI CCNNGG 3 cut(s) 37, 183, 312
BseBI CCWGG 1 cut(s) 184
BseDI CCNNGG 3 cut(s) 37, 183, 312
BseMII CTCAG 2 cut(s) 117, 351
BseXI GCAGC 1 cut(s) 181
BsiHKAI GWGCWC 1 cut(s) 149
BslFI GGGAC 1 cut(s) 86
BsmAI GTCTC 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 86
Bso31I GGTCTC 1 cut(s) 203
Bsp1286I GDGCHC 1 cut(s) 149
Bsp19I CCATGG 1 cut(s) 37
BspACI CCGC 1 cut(s) 234
BspCNI CTCAG 2 cut(s) 118, 350
BspHI TCATGA 2 cut(s) 12, 162
BspLI GGNNCC 1 cut(s) 64
BspTNI GGTCTC 1 cut(s) 203
BssECI CCNNGG 3 cut(s) 37, 183, 312
BssT1I CCWWGG 2 cut(s) 37, 312
Bst2UI CCWGG 1 cut(s) 184
Bst4CI ACNGT 1 cut(s) 265
Bst6I CTCTTC 1 cut(s) 78
BstDEI CTNAG 2 cut(s) 126, 337
BstDSI CCRYGG 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 203
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 182
BstV1I GCAGC 1 cut(s) 181
BstV2I GAAGAC 1 cut(s) 266
BstXI CCANNNNNNTGG 1 cut(s) 38
BtgI CCRYGG 1 cut(s) 37
BtgZI GCGATG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 97
CciI TCATGA 2 cut(s) 12, 162
Cfr13I GGNCC 1 cut(s) 117
CviAII CATG 6 cut(s) 13, 38, 43, 67, 163, 344
CviJI RGCY 7 cut(s) 36, 49, 65, 125, 147, 160, 317
CviKI_1 RGCY 7 cut(s) 36, 49, 65, 125, 147, 160, 317
DdeI CTNAG 2 cut(s) 126, 337
Eam1104I CTCTTC 1 cut(s) 78
EarI CTCTTC 1 cut(s) 78
EciI GGCGGA 1 cut(s) 249
Ecl136II GAGCTC 1 cut(s) 147
Eco130I CCWWGG 2 cut(s) 37, 312
Eco24I GRGCYC 1 cut(s) 149
Eco31I GGTCTC 1 cut(s) 203
Eco47I GGWCC 1 cut(s) 117
Eco53kI GAGCTC 1 cut(s) 147
EcoICRI GAGCTC 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 182
EcoT14I CCWWGG 2 cut(s) 37, 312
EcoT38I GRGCYC 1 cut(s) 149
ErhI CCWWGG 2 cut(s) 37, 312
FaeI CATG 6 cut(s) 16, 41, 46, 70, 166, 347
FaiI YATR 8 cut(s) 14, 39, 44, 68, 122, 164, 278, 345
FaqI GGGAC 1 cut(s) 86
FatI CATG 6 cut(s) 12, 37, 42, 66, 162, 343
Fnu4HI GCNGC 1 cut(s) 195
FriOI GRGCYC 1 cut(s) 149
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 1 cut(s) 51
GluI GCNGC 1 cut(s) 195
Hin1II CATG 6 cut(s) 16, 41, 46, 70, 166, 347
HincII GTYRAC 1 cut(s) 325
HindII GTYRAC 1 cut(s) 325
HinfI GANTC 2 cut(s) 95, 109
Hpy166II GTNNAC 2 cut(s) 286, 325
Hpy188I TCNGA 3 cut(s) 62, 151, 223
Hpy188III TCNNGA 3 cut(s) 13, 163, 268
Hpy8I GTNNAC 2 cut(s) 286, 325
HpyCH4III ACNGT 1 cut(s) 265
HpyCH4V TGCA 3 cut(s) 78, 178, 306
HpyF3I CTNAG 2 cut(s) 126, 337
Hsp92II CATG 6 cut(s) 16, 41, 46, 70, 166, 347
LmnI GCTCC 2 cut(s) 62, 144
LpnPI CCDG 2 cut(s) 169, 196
Lsp1109I GCAGC 1 cut(s) 181
LweI GCATC 2 cut(s) 87, 94
MaeI CTAG 1 cut(s) 51
MboII GAAGA 2 cut(s) 95, 271
MfeI CAATTG 1 cut(s) 296
MhlI GDGCHC 1 cut(s) 149
MluCI AATT 6 cut(s) 152, 238, 253, 279, 296, 307
MmeI TCCRAC 1 cut(s) 40
MnlI CCTC 4 cut(s) 16, 63, 264, 346
MseI TTAA 1 cut(s) 349
MslI CAYNNNNRTG 1 cut(s) 281
MspR9I CCNGG 1 cut(s) 184
MunI CAATTG 1 cut(s) 296
MvaI CCWGG 1 cut(s) 184
NcoI CCATGG 1 cut(s) 37
NlaIII CATG 6 cut(s) 16, 41, 46, 70, 166, 347
NlaIV GGNNCC 1 cut(s) 64
PagI TCATGA 2 cut(s) 12, 162
PcsI WCGNNNNNNNCGW 1 cut(s) 104
PfeI GAWTC 2 cut(s) 95, 109
PkrI GCNGC 1 cut(s) 196
Psp124BI GAGCTC 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
PspN4I GGNNCC 1 cut(s) 64
PspPI GGNCC 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 281
SacI GAGCTC 1 cut(s) 149
SaqAI TTAA 1 cut(s) 349
SatI GCNGC 1 cut(s) 195
Sau96I GGNCC 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 184
SduI GDGCHC 1 cut(s) 149
SetI ASST 5 cut(s) 119, 127, 149, 162, 185
SfaNI GCATC 2 cut(s) 87, 94
SinI GGWCC 1 cut(s) 117
SmiMI CAYNNNNRTG 1 cut(s) 281
Sse9I AATT 6 cut(s) 152, 238, 253, 279, 296, 307
SsiI CCGC 1 cut(s) 234
SspMI CTAG 1 cut(s) 51
SstI GAGCTC 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 182
StyI CCWWGG 2 cut(s) 37, 312
TaaI ACNGT 1 cut(s) 265
TaqI TCGA 1 cut(s) 81
TasI AATT 6 cut(s) 152, 238, 253, 279, 296, 307
TfiI GAWTC 2 cut(s) 95, 109
Tru1I TTAA 1 cut(s) 349
Tru9I TTAA 1 cut(s) 349
TscAI CASTG 1 cut(s) 97
TseI GCWGC 1 cut(s) 194
TspDTI ATGAA 3 cut(s) 59, 260, 332
TspRI CASTG 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 117
XapI RAATTY 2 cut(s) 152, 238
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.