MD08G1185200.v1.1

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
23211606 .. 23211984
379 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1185200.v1.1.491

Sequence Viewer

Length: 276 bp
ATGATTTGTTGGTCTTTCTGTGGAGAGCAACCAACCAATTGTAGGTACAGTTGCAAAGAGTGGGGCATTGGATTCGAGTTAGGGGATGATGTTAAAAGAGATTATGTAGAGGGACTTGTGAGAAAGTTAACGGAGGGAGGGGAGGGCAAAGAGATGAAGAAGAATGCCTTAGAGTGGAAGAAGTTGGCAAAGGAGGCAACTACTTGTCCGAATGGGTTGTCTTTCTTGGCCTTGGACAAATTGATTAACCAGGTGCTTCTTTCTTCAAGAAAATGA

Protein Analysis

92

Amino Acids

10.3

Weight (kDa)

8.28

Isoelectric Point (pI)

15.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 2 cut(s) 42, 174
AgsI TTSAA 1 cut(s) 267
AjnI CCWGG 1 cut(s) 249
AoxI GGCC 1 cut(s) 228
ArsI GACNNNNNNTTYG 2 cut(s) 203, 235
BcgI CGANNNNNNTGC 2 cut(s) 55, 89
BciT130I CCWGG 1 cut(s) 251
Bme1390I CCNGG 1 cut(s) 251
BmrFI CCNGG 1 cut(s) 251
BsaJI CCNNGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 2 cut(s) 42, 174
BseBI CCWGG 1 cut(s) 251
BseDI CCNNGG 1 cut(s) 231
BseGI GGATG 1 cut(s) 91
BseLI CCNNNNNNNGG 2 cut(s) 42, 174
BshFI GGCC 1 cut(s) 230
BslFI GGGAC 1 cut(s) 126
BslI CCNNNNNNNGG 2 cut(s) 42, 174
BsmFI GGGAC 1 cut(s) 126
BsmI GAATGC 1 cut(s) 169
BsnI GGCC 1 cut(s) 230
BspANI GGCC 1 cut(s) 230
BssECI CCNNGG 1 cut(s) 231
BssT1I CCWWGG 1 cut(s) 231
Bst2UI CCWGG 1 cut(s) 251
Bst4CI ACNGT 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 169
BstF5I GGATG 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstNI CCWGG 1 cut(s) 251
BstSCI CCNGG 1 cut(s) 249
BsuRI GGCC 1 cut(s) 230
BtsCI GGATG 1 cut(s) 91
CsiI ACCWGGT 1 cut(s) 249
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 1 cut(s) 230
CviKI_1 RGCY 1 cut(s) 230
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 169
Eco130I CCWWGG 1 cut(s) 231
EcoRII CCWGG 1 cut(s) 249
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaiI YATR 1 cut(s) 105
FalI AAGNNNNNCTT 2 cut(s) 152, 184
FaqI GGGAC 1 cut(s) 126
FokI GGATG 1 cut(s) 98
HaeIII GGCC 1 cut(s) 230
HincII GTYRAC 1 cut(s) 129
HindII GTYRAC 1 cut(s) 129
HinfI GANTC 1 cut(s) 72
HpaI GTTAAC 1 cut(s) 129
Hpy166II GTNNAC 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 267
Hpy8I GTNNAC 1 cut(s) 129
HpyCH4III ACNGT 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 54
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 169
KspAI GTTAAC 1 cut(s) 129
LpnPI CCDG 2 cut(s) 236, 263
MabI ACCWGGT 1 cut(s) 249
MboII GAAGA 4 cut(s) 169, 172, 190, 255
MfeI CAATTG 1 cut(s) 37
MluCI AATT 2 cut(s) 37, 239
MnlI CCTC 5 cut(s) 103, 127, 131, 136, 187
MseI TTAA 3 cut(s) 93, 128, 246
MspR9I CCNGG 1 cut(s) 251
MunI CAATTG 1 cut(s) 37
Mva1269I GAATGC 1 cut(s) 169
MvaI CCWGG 1 cut(s) 251
MwoI GCNNNNNNNGC 1 cut(s) 194
PctI GAATGC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 72
Psp6I CCWGG 1 cut(s) 249
PspGI CCWGG 1 cut(s) 249
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SaqAI TTAA 3 cut(s) 93, 128, 246
ScrFI CCNGG 1 cut(s) 251
SetI ASST 2 cut(s) 47, 255
SexAI ACCWGGT 1 cut(s) 249
SgeI CNNG 7 cut(s) 88, 128, 216, 238, 244, 262, 263
Sse9I AATT 2 cut(s) 37, 239
StyD4I CCNGG 1 cut(s) 249
StyI CCWWGG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 50
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 37, 239
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 3 cut(s) 93, 128, 246
Tru9I TTAA 3 cut(s) 93, 128, 246
TspDTI ATGAA 1 cut(s) 170
TspGWI ACGGA 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.