Rh7CG493100

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
66253983 .. 66254186
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG493100.1

Sequence Viewer

Length: 204 bp
ATGGAAATTGAGGGCGATCCCAAGAGAGATTACATAGAAGGGCTTGTAAGGAAGTTGATGGAGAGAGAAGAAGGGAAAGAGATGAAGAAGAAAGCTCTGGAATGGAAGAGGTTGGCAATGGAGGTCGCCACTGGTCCTAAGGGTTCGTCTTTTGTGAACTTGGACAAGATGGTCAACAAGGTTCTTCTAGCTCCCAGAAAATAA

Protein Analysis

67

Amino Acids

7.75

Weight (kDa)

9.52

Isoelectric Point (pI)

43.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AclWI GGATC 1 cut(s) 11
AluBI AGCT 2 cut(s) 95, 191
AluI AGCT 2 cut(s) 95, 191
AlwI GGATC 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 134
AvaII GGWCC 1 cut(s) 134
AxyI CCTNAGG 1 cut(s) 138
BccI CCATC 2 cut(s) 52, 163
BfaI CTAG 1 cut(s) 188
Bme18I GGWCC 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 134
Bse1I ACTGG 1 cut(s) 136
Bse21I CCTNAGG 1 cut(s) 138
Bse3DI GCAATG 1 cut(s) 123
BseMI GCAATG 1 cut(s) 123
BseNI ACTGG 1 cut(s) 136
Bsp143I GATC 1 cut(s) 16
BspPI GGATC 1 cut(s) 11
BsrDI GCAATG 1 cut(s) 123
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 138
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
Bsu36I CCTNAGG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 134
CviJI RGCY 3 cut(s) 43, 95, 191
CviKI_1 RGCY 3 cut(s) 43, 95, 191
DdeI CTNAG 1 cut(s) 138
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco47I GGWCC 1 cut(s) 134
Eco81I CCTNAGG 1 cut(s) 138
FaiI YATR 1 cut(s) 35
FspBI CTAG 1 cut(s) 188
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 157, 175
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 2 cut(s) 157, 175
HpyAV CCTTC 2 cut(s) 32, 65
HpyF3I CTNAG 1 cut(s) 138
Kzo9I GATC 1 cut(s) 16
LmnI GCTCC 1 cut(s) 196
LpnPI CCDG 2 cut(s) 83, 117
MaeI CTAG 1 cut(s) 188
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 5 cut(s) 80, 97, 100, 118, 176
MluCI AATT 1 cut(s) 6
MnlI CCTC 3 cut(s) 4, 102, 115
NdeII GATC 1 cut(s) 16
PspPI GGNCC 1 cut(s) 134
Sau3AI GATC 1 cut(s) 16
Sau96I GGNCC 1 cut(s) 134
SetI ASST 5 cut(s) 97, 113, 126, 183, 193
SgeI CNNG 8 cut(s) 34, 56, 110, 144, 172, 178, 190, 200
SinI GGWCC 1 cut(s) 134
Sse9I AATT 1 cut(s) 6
SspMI CTAG 1 cut(s) 188
TasI AATT 1 cut(s) 6
TscAI CASTG 1 cut(s) 136
TspDTI ATGAA 1 cut(s) 98
TspRI CASTG 1 cut(s) 136
VpaK11BI GGWCC 1 cut(s) 134
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.