Rmu_sc0012977.1_g000003

UDP-Glycosyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012977.1
OG0007481
Physical Location & Seq
Forward (+)
4226 .. 4711
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012977.1_g000003.1.cds

Sequence Viewer

Length: 486 bp
atgtgggttattaggcctggtttggtaatgagcgaatcagcaactttgccacctgagtttgtagctgaaaccaaagaaagaggtttgatagtgagttggtgtccacatgaggaagtccttaatcacccatcagttggagggtttctaacacactgcggttggcattcaaccatggagagtttgactcctggagtgcctatgatctgttggccattctttacagaactgcagacaaactgttacaagatttgtaaagaatggggcataggaatggagatcggtagtgatgtgaagagagacgaagttcagaagctcgttaaagagataatggaaggagagaagggtaagactatgagaaaaaatatattggaatggaagaagcttgcaaaagaagcaattgctccgcatgggtcctcattcaaaaatctagacattctagtgaatcaagttctactaagaaaaagagaaggtcgggcaggtgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

161

Amino Acids

18.23

Weight (kDa)

7.66

Isoelectric Point (pI)

37.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 467
Acc36I ACCTGC 1 cut(s) 467
AccB7I CCANNNNNTGG 1 cut(s) 134
AciI CCGC 2 cut(s) 156, 404
AcoI YGGCCR 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 2 cut(s) 168, 421
AjnI CCWGG 2 cut(s) 16, 187
AluBI AGCT 3 cut(s) 65, 313, 382
AluI AGCT 3 cut(s) 65, 313, 382
Alw26I GTCTC 1 cut(s) 291
AoxI GGCC 2 cut(s) 14, 209
AspS9I GGNCC 1 cut(s) 411
AsuHPI GGTGA 1 cut(s) 116
AvaII GGWCC 1 cut(s) 411
BalI TGGCCA 1 cut(s) 211
BccI CCATC 1 cut(s) 136
BciT130I CCWGG 2 cut(s) 18, 189
BcoDI GTCTC 1 cut(s) 291
BfaI CTAG 2 cut(s) 428, 437
BfmI CTRYAG 1 cut(s) 227
BfuAI ACCTGC 1 cut(s) 467
Bme1390I CCNGG 2 cut(s) 18, 189
Bme18I GGWCC 1 cut(s) 411
BmgT120I GGNCC 1 cut(s) 411
BmiI GGNNCC 1 cut(s) 412
BmrFI CCNGG 2 cut(s) 18, 189
BplI GAGNNNNNCTC 2 cut(s) 169, 201
BpmI CTGGAG 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 171
Bsc4I CCNNNNNNNGG 1 cut(s) 134
BseBI CCWGG 2 cut(s) 18, 189
BseDI CCNNGG 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 134
BseMII CTCAG 1 cut(s) 45
BshFI GGCC 2 cut(s) 16, 211
BslI CCNNNNNNNGG 1 cut(s) 134
BsmAI GTCTC 1 cut(s) 291
BsmBI CGTCTC 1 cut(s) 291
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 2 cut(s) 16, 211
Bsp143I GATC 2 cut(s) 201, 276
Bsp19I CCATGG 1 cut(s) 171
BspACI CCGC 2 cut(s) 156, 404
BspANI GGCC 2 cut(s) 16, 211
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 1 cut(s) 412
BspMAI CTGCAG 1 cut(s) 231
BspMI ACCTGC 1 cut(s) 467
BssECI CCNNGG 1 cut(s) 171
BssMI GATC 2 cut(s) 201, 276
BssT1I CCWWGG 1 cut(s) 171
Bst2UI CCWGG 2 cut(s) 18, 189
Bst4CI ACNGT 1 cut(s) 239
Bst6I CTCTTC 1 cut(s) 287
BstC8I GCNNGC 1 cut(s) 384
BstDEI CTNAG 2 cut(s) 54, 455
BstDSI CCRYGG 1 cut(s) 171
BstKTI GATC 2 cut(s) 204, 279
BstMAI GTCTC 1 cut(s) 291
BstMBI GATC 2 cut(s) 201, 276
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNI CCWGG 2 cut(s) 18, 189
BstSCI CCNGG 2 cut(s) 16, 187
BstSFI CTRYAG 1 cut(s) 227
BsuRI GGCC 2 cut(s) 16, 211
BtgI CCRYGG 1 cut(s) 171
BtsI GCAGTG 1 cut(s) 151
BtsIMutI CAGTG 1 cut(s) 151
BveI ACCTGC 1 cut(s) 467
Cac8I GCNNGC 1 cut(s) 384
Cfr13I GGNCC 1 cut(s) 411
CviAII CATG 3 cut(s) 107, 172, 407
CviJI RGCY 5 cut(s) 16, 65, 211, 313, 382
CviKI_1 RGCY 5 cut(s) 16, 65, 211, 313, 382
DdeI CTNAG 2 cut(s) 54, 455
DpnI GATC 2 cut(s) 203, 278
DpnII GATC 2 cut(s) 201, 276
EaeI YGGCCR 1 cut(s) 209
Eam1104I CTCTTC 1 cut(s) 287
EarI CTCTTC 1 cut(s) 287
Eco130I CCWWGG 1 cut(s) 171
Eco147I AGGCCT 1 cut(s) 16
Eco47I GGWCC 1 cut(s) 411
EcoO109I RGGNCCY 1 cut(s) 411
EcoRII CCWGG 2 cut(s) 16, 187
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
Esp3I CGTCTC 1 cut(s) 291
FaeI CATG 3 cut(s) 110, 175, 410
FaiI YATR 7 cut(s) 108, 173, 200, 266, 353, 365, 408
FatI CATG 3 cut(s) 106, 171, 406
FspBI CTAG 2 cut(s) 428, 437
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 16, 211
Hin1II CATG 3 cut(s) 110, 175, 410
HindIII AAGCTT 1 cut(s) 380
HinfI GANTC 3 cut(s) 35, 184, 442
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 104
Hpy188I TCNGA 1 cut(s) 309
Hpy188III TCNNGA 1 cut(s) 428
Hpy8I GTNNAC 1 cut(s) 104
HpyAV CCTTC 3 cut(s) 326, 334, 461
HpyCH4III ACNGT 1 cut(s) 239
HpyCH4V TGCA 2 cut(s) 229, 386
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpyF3I CTNAG 2 cut(s) 54, 455
Hsp92II CATG 3 cut(s) 110, 175, 410
Kzo9I GATC 2 cut(s) 201, 276
LmnI GCTCC 1 cut(s) 406
LpnPI CCDG 6 cut(s) 3, 30, 66, 174, 201, 462
MaeI CTAG 2 cut(s) 428, 437
MaeIII GTNAC 1 cut(s) 239
MalI GATC 2 cut(s) 203, 278
MboI GATC 2 cut(s) 201, 276
MboII GAAGA 2 cut(s) 304, 388
MfeI CAATTG 1 cut(s) 396
MlsI TGGCCA 1 cut(s) 211
MluCI AATT 1 cut(s) 396
MluNI TGGCCA 1 cut(s) 211
MlyI GAGTC 1 cut(s) 178
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 4 cut(s) 74, 103, 131, 424
Mox20I TGGCCA 1 cut(s) 211
MscI TGGCCA 1 cut(s) 211
MseI TTAA 2 cut(s) 120, 318
MslI CAYNNNNRTG 2 cut(s) 269, 437
Msp20I TGGCCA 1 cut(s) 211
MspR9I CCNGG 2 cut(s) 18, 189
MunI CAATTG 1 cut(s) 396
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 2 cut(s) 18, 189
MwoI GCNNNNNNNGC 1 cut(s) 392
NcoI CCATGG 1 cut(s) 171
NdeII GATC 2 cut(s) 201, 276
NlaIII CATG 3 cut(s) 110, 175, 410
NlaIV GGNNCC 1 cut(s) 412
PaqCI CACCTGC 1 cut(s) 467
PceI AGGCCT 1 cut(s) 16
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 2 cut(s) 35, 442
PflMI CCANNNNNTGG 1 cut(s) 134
PfoI TCCNGGA 1 cut(s) 187
PleI GAGTC 1 cut(s) 178
PpsI GAGTC 1 cut(s) 178
PpuMI RGGWCCY 1 cut(s) 411
Psp5II RGGWCCY 1 cut(s) 411
Psp6I CCWGG 2 cut(s) 16, 187
PspGI CCWGG 2 cut(s) 16, 187
PspN4I GGNNCC 1 cut(s) 412
PspPI GGNCC 1 cut(s) 411
PspPPI RGGWCCY 1 cut(s) 411
PstI CTGCAG 1 cut(s) 231
RseI CAYNNNNRTG 2 cut(s) 269, 437
SaqAI TTAA 2 cut(s) 120, 318
Sau3AI GATC 2 cut(s) 201, 276
Sau96I GGNCC 1 cut(s) 411
SchI GAGTC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 18, 189
SetI ASST 7 cut(s) 55, 67, 85, 315, 384, 472, 481
SfcI CTRYAG 1 cut(s) 227
SinI GGWCC 1 cut(s) 411
SmiMI CAYNNNNRTG 2 cut(s) 269, 437
Sse9I AATT 1 cut(s) 396
SseBI AGGCCT 1 cut(s) 16
SsiI CCGC 2 cut(s) 156, 404
SspMI CTAG 2 cut(s) 428, 437
StuI AGGCCT 1 cut(s) 16
StyD4I CCNGG 2 cut(s) 16, 187
StyI CCWWGG 1 cut(s) 171
TaaI ACNGT 1 cut(s) 239
TasI AATT 1 cut(s) 396
TfiI GAWTC 2 cut(s) 35, 442
Tru1I TTAA 2 cut(s) 120, 318
Tru9I TTAA 2 cut(s) 120, 318
TscAI CASTG 1 cut(s) 158
TspRI CASTG 1 cut(s) 158
Van91I CCANNNNNTGG 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 411
XbaI TCTAGA 1 cut(s) 427
XspI CTAG 2 cut(s) 428, 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.