Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr09

Orthogroup ID

OG0007481

Physical Location & Seq

Genomic Coordinates Forward (+)

11168210 .. 11168458

Gene Structure 249 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD09G1143200.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

ATGGACTGCCGCTATAGTTGCAATGAATGGGGCATTGGCATGGAAATTAGTAATGATGTAAAGAGGGATGAAGAAGAGAAGCTTGTCAGAGAGTTAATGGATGGGGAGAAGGGTAAGAAGATGAAAAATAAGGTTATGATGTGGAAGAAGCTTGCAGAAGAAGCTACTGGTCCACATGGTTCCTCATCCAAAAACTTAGACATGCTAGTGAATCAAGTGCTACTAAGAAAAACTAGACGTCATCTGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UDPGT

Protein Analysis

83

Amino Acids

9.58

Weight (kDa)

8.98

Isoelectric Point (pI)

39.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007481)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g20573 FvH4_6g39800
malus_domestica	MD08G1185200.v1.1 MD09G1143200.v1.1 MD13G1080400.v1.1 MD16G1231200.v1.1 MD17G1126100.v1.1
rosa_chinensis	RchiOBHm_Chr2g0124491
rosa_laevigata	RLG00000020768
rosa_multiflora	Rmu_co8063878.1_g000001 Rmu_co8251247.1_g000001 Rmu_co8298997.1_g000001 Rmu_sc0006451.1_g000003 Rmu_sc0012977.1_g000003
rosa_roxburghii	Rroxscaffold_2G00154720 Rroxscaffold_3G00221760
rosa_rugosa	Rorug07G0320700
rosa_samantha	Rh2BG252200 Rh2BG318400 Rh2BG517200 Rh2BG518700 Rh2BG519200 Rh5BG203200 Rh7CG493100 Rh7CG493600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	241
AciI	CCGC	1 cut(s)	10
AcyI	GRCGYC	1 cut(s)	238
AjuI	GAANNNNNNNTTGG	2 cut(s)	18, 50
AluBI	AGCT	3 cut(s)	82, 151, 164
AluI	AGCT	3 cut(s)	82, 151, 164
AspS9I	GGNCC	1 cut(s)	170
AvaII	GGWCC	1 cut(s)	170
BccI	CCATC	1 cut(s)	95
BfaI	CTAG	2 cut(s)	206, 234
BfmI	CTRYAG	1 cut(s)	13
BisI	GCNGC	1 cut(s)	10
BlsI	GCNGC	1 cut(s)	11
Bme18I	GGWCC	1 cut(s)	170
BmgT120I	GGNCC	1 cut(s)	170
BmiI	GGNNCC	1 cut(s)	181
BsaHI	GRCGYC	1 cut(s)	238
Bse1I	ACTGG	1 cut(s)	172
Bse3DI	GCAATG	1 cut(s)	28
BseGI	GGATG	3 cut(s)	73, 106, 185
BseMI	GCAATG	1 cut(s)	28
BseNI	ACTGG	1 cut(s)	172
BspACI	CCGC	1 cut(s)	10
BspLI	GGNNCC	1 cut(s)	181
BsrDI	GCAATG	1 cut(s)	28
BsrI	ACTGG	1 cut(s)	172
BssNI	GRCGYC	1 cut(s)	238
Bst6I	CTCTTC	1 cut(s)	69
BstACI	GRCGYC	1 cut(s)	238
BstC8I	GCNNGC	1 cut(s)	153
BstDEI	CTNAG	2 cut(s)	196, 224
BstF5I	GGATG	3 cut(s)	73, 106, 185
BstMWI	GCNNNNNNNGC	2 cut(s)	18, 161
BstNSI	RCATGY	1 cut(s)	205
BstSFI	CTRYAG	1 cut(s)	13
BtsCI	GGATG	3 cut(s)	73, 106, 185
Cac8I	GCNNGC	1 cut(s)	153
Cfr13I	GGNCC	1 cut(s)	170
CviAII	CATG	3 cut(s)	40, 176, 202
CviJI	RGCY	3 cut(s)	82, 151, 164
CviKI_1	RGCY	3 cut(s)	82, 151, 164
DdeI	CTNAG	2 cut(s)	196, 224
Eam1104I	CTCTTC	1 cut(s)	69
EarI	CTCTTC	1 cut(s)	69
Eco47I	GGWCC	1 cut(s)	170
FaeI	CATG	3 cut(s)	43, 179, 205
FaiI	YATR	5 cut(s)	15, 41, 137, 177, 203
FalI	AAGNNNNNCTT	2 cut(s)	66, 98
FatI	CATG	3 cut(s)	39, 175, 201
Fnu4HI	GCNGC	1 cut(s)	10
FokI	GGATG	3 cut(s)	80, 113, 172
Fsp4HI	GCNGC	1 cut(s)	10
FspBI	CTAG	2 cut(s)	206, 234
GluI	GCNGC	1 cut(s)	10
Hin1I	GRCGYC	1 cut(s)	238
Hin1II	CATG	3 cut(s)	43, 179, 205
HindIII	AAGCTT	2 cut(s)	80, 149
HinfI	GANTC	1 cut(s)	211
Hpy166II	GTNNAC	1 cut(s)	173
Hpy188I	TCNGA	1 cut(s)	89
Hpy8I	GTNNAC	1 cut(s)	173
HpyAV	CCTTC	1 cut(s)	103
HpyCH4IV	ACGT	1 cut(s)	238
HpyCH4V	TGCA	2 cut(s)	21, 155
HpyF10VI	GCNNNNNNNGC	2 cut(s)	18, 161
HpyF3I	CTNAG	2 cut(s)	196, 224
HpySE526I	ACGT	1 cut(s)	238
Hsp92I	GRCGYC	1 cut(s)	238
Hsp92II	CATG	3 cut(s)	43, 179, 205
LpnPI	CCDG	1 cut(s)	153
MaeI	CTAG	2 cut(s)	206, 234
MaeII	ACGT	1 cut(s)	238
MboII	GAAGA	5 cut(s)	83, 86, 130, 157, 170
MluCI	AATT	1 cut(s)	45
MnlI	CCTC	2 cut(s)	57, 193
MseI	TTAA	1 cut(s)	95
MslI	CAYNNNNRTG	2 cut(s)	38, 206
MwoI	GCNNNNNNNGC	2 cut(s)	18, 161
NlaIII	CATG	3 cut(s)	43, 179, 205
NlaIV	GGNNCC	1 cut(s)	181
NspI	RCATGY	1 cut(s)	205
PfeI	GAWTC	1 cut(s)	211
PkrI	GCNGC	1 cut(s)	11
PspN4I	GGNNCC	1 cut(s)	181
PspPI	GGNCC	1 cut(s)	170
RseI	CAYNNNNRTG	2 cut(s)	38, 206
SaqAI	TTAA	1 cut(s)	95
SatI	GCNGC	1 cut(s)	10
Sau96I	GGNCC	1 cut(s)	170
SetI	ASST	5 cut(s)	84, 135, 153, 166, 241
SfcI	CTRYAG	1 cut(s)	13
SgeI	CNNG	8 cut(s)	52, 95, 164, 180, 188, 214, 218, 227
SinI	GGWCC	1 cut(s)	170
SmiMI	CAYNNNNRTG	2 cut(s)	38, 206
Sse9I	AATT	1 cut(s)	45
SsiI	CCGC	1 cut(s)	10
SspMI	CTAG	2 cut(s)	206, 234
TaiI	ACGT	1 cut(s)	241
TasI	AATT	1 cut(s)	45
TauI	GCSGC	1 cut(s)	12
TfiI	GAWTC	1 cut(s)	211
Tru1I	TTAA	1 cut(s)	95
Tru9I	TTAA	1 cut(s)	95
TspDTI	ATGAA	3 cut(s)	39, 84, 137
VpaK11BI	GGWCC	1 cut(s)	170
XceI	RCATGY	1 cut(s)	205
XspI	CTAG	2 cut(s)	206, 234
ZraI	GACGTC	1 cut(s)	239

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.