Rmu_co8251247.1_g000001

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8251247.1
Physical Location & Seq
Reverse (-)
347 .. 652
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8251247.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
atgttggaaagtgtaggtgagggtgtgcctgtgatttgctggcctttctttgctgatcaacaaaccaattgtggatttgcttgtggacgttggggcattggattggaggtcaagcatgatgtgaagaaatgtgaaattgaaggagttgttaaggaaatgatggaaggggagaaggggaaggagttgaagcaaaatgcattgaaatggaggaagaaggcaattggagctactgacattggtggagcatcttatggtaattttgatagaatgatggagcatcttattaaaaaggtggagaatggttga

Protein Analysis

101

Amino Acids

11.23

Weight (kDa)

6.72

Isoelectric Point (pI)

21.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 140, 187, 202
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AoxI GGCC 1 cut(s) 41
AsuHPI GGTGA 1 cut(s) 29
BccI CCATC 2 cut(s) 154, 265
BclI TGATCA 1 cut(s) 55
BmsI GCATC 2 cut(s) 254, 286
BshFI GGCC 1 cut(s) 43
BsnI GGCC 1 cut(s) 43
Bsp143I GATC 1 cut(s) 55
BspANI GGCC 1 cut(s) 43
BssMI GATC 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 41
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 224
BsuRI GGCC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 41
CviAII CATG 1 cut(s) 116
CviJI RGCY 2 cut(s) 43, 227
CviKI_1 RGCY 2 cut(s) 43, 227
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 199
FaeI CATG 1 cut(s) 119
FaiI YATR 2 cut(s) 117, 252
FatI CATG 1 cut(s) 115
FbaI TGATCA 1 cut(s) 55
HaeIII GGCC 1 cut(s) 43
Hin1II CATG 1 cut(s) 119
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 86
HpyAV CCTTC 5 cut(s) 134, 158, 166, 172, 208
HpyCH4IV ACGT 1 cut(s) 88
HpyCH4V TGCA 1 cut(s) 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpySE526I ACGT 1 cut(s) 88
Hsp92II CATG 1 cut(s) 119
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 3 cut(s) 224, 242, 274
LpnPI CCDG 2 cut(s) 25, 42
LweI GCATC 2 cut(s) 254, 286
MaeII ACGT 1 cut(s) 88
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 2 cut(s) 136, 223
MfeI CAATTG 2 cut(s) 67, 219
MluCI AATT 4 cut(s) 67, 135, 219, 256
MnlI CCTC 3 cut(s) 13, 100, 201
Mph1103I ATGCAT 1 cut(s) 199
MseI TTAA 2 cut(s) 150, 285
MslI CAYNNNNRTG 1 cut(s) 202
MunI CAATTG 2 cut(s) 67, 219
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 1 cut(s) 55
NlaIII CATG 1 cut(s) 119
NsiI ATGCAT 1 cut(s) 199
RseI CAYNNNNRTG 1 cut(s) 202
SaqAI TTAA 2 cut(s) 150, 285
Sau3AI GATC 1 cut(s) 55
SetI ASST 5 cut(s) 19, 91, 111, 229, 294
SfaNI GCATC 2 cut(s) 254, 286
SgeI CNNG 5 cut(s) 41, 52, 93, 124, 128
SmiMI CAYNNNNRTG 1 cut(s) 202
Sse9I AATT 4 cut(s) 67, 135, 219, 256
TaiI ACGT 1 cut(s) 91
TasI AATT 4 cut(s) 67, 135, 219, 256
Tru1I TTAA 2 cut(s) 150, 285
Tru9I TTAA 2 cut(s) 150, 285
Zsp2I ATGCAT 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.