Rh2BG318400

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
37867416 .. 37867631
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG318400.1

Sequence Viewer

Length: 216 bp
ATGGAGATCGGTAGTGATGTGAAGAGAGACGAAGTTCAGAAGCTCGTTAAAGAGATAATGGAGGGAGAGAAGGGTAAGACTATGAGAAAAAATATCTTGGAATGGAAGAAGCTTGCAAAAGAAGCAATTGCTCAGCATGGGTCCTCATTCAAAAATCTAGACATTCTAGTGAATCAAGTTCTACTAAGAAAAAGAGAAGGCCGGGCAGGTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.12

Weight (kDa)

9.75

Isoelectric Point (pI)

25.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 197
Acc36I ACCTGC 1 cut(s) 197
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 2 cut(s) 43, 112
AluI AGCT 2 cut(s) 43, 112
Alw26I GTCTC 1 cut(s) 21
AoxI GGCC 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 141
AsuC2I CCSGG 1 cut(s) 203
AvaII GGWCC 1 cut(s) 141
BcnI CCSGG 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 21
BfaI CTAG 2 cut(s) 158, 167
BfuAI ACCTGC 1 cut(s) 197
BlpI GCTNAGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 203
Bpu1102I GCTNAGC 1 cut(s) 132
BpuMI CCSGG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 146
BshFI GGCC 1 cut(s) 201
BsiSI CCGG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 21
BsmBI CGTCTC 1 cut(s) 21
BsnI GGCC 1 cut(s) 201
Bsp143I GATC 1 cut(s) 6
Bsp1720I GCTNAGC 1 cut(s) 132
BspANI GGCC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 142
BspMI ACCTGC 1 cut(s) 197
BssMI GATC 1 cut(s) 6
Bst6I CTCTTC 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 2 cut(s) 132, 185
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 21
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 201
BsuRI GGCC 1 cut(s) 201
BveI ACCTGC 1 cut(s) 197
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 141
CviAII CATG 1 cut(s) 137
CviJI RGCY 3 cut(s) 43, 112, 201
CviKI_1 RGCY 3 cut(s) 43, 112, 201
DdeI CTNAG 2 cut(s) 132, 185
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eam1104I CTCTTC 1 cut(s) 17
EarI CTCTTC 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 141
EcoO109I RGGNCCY 1 cut(s) 141
Esp3I CGTCTC 1 cut(s) 21
FaeI CATG 1 cut(s) 140
FaiI YATR 2 cut(s) 83, 138
FatI CATG 1 cut(s) 136
FspBI CTAG 2 cut(s) 158, 167
HaeIII GGCC 1 cut(s) 201
HapII CCGG 1 cut(s) 202
Hin1II CATG 1 cut(s) 140
HindIII AAGCTT 1 cut(s) 110
HinfI GANTC 1 cut(s) 172
HpaII CCGG 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 2 cut(s) 64, 191
HpyCH4V TGCA 1 cut(s) 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 132, 185
Hsp92II CATG 1 cut(s) 140
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 1 cut(s) 192
MaeI CTAG 2 cut(s) 158, 167
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 34, 118
MfeI CAATTG 1 cut(s) 126
MluCI AATT 1 cut(s) 126
MnlI CCTC 2 cut(s) 55, 154
MseI TTAA 1 cut(s) 48
MslI CAYNNNNRTG 1 cut(s) 167
MspI CCGG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 203
MunI CAATTG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 122
NciI CCSGG 1 cut(s) 203
NdeII GATC 1 cut(s) 6
NlaIII CATG 1 cut(s) 140
NlaIV GGNNCC 1 cut(s) 142
PaqCI CACCTGC 1 cut(s) 197
PfeI GAWTC 1 cut(s) 172
PpuMI RGGWCCY 1 cut(s) 141
Psp5II RGGWCCY 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 142
PspPI GGNCC 1 cut(s) 141
PspPPI RGGWCCY 1 cut(s) 141
RseI CAYNNNNRTG 1 cut(s) 167
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 203
SetI ASST 3 cut(s) 45, 114, 211
SgeI CNNG 7 cut(s) 56, 109, 125, 149, 170, 179, 188
SinI GGWCC 1 cut(s) 141
SmiMI CAYNNNNRTG 1 cut(s) 167
Sse9I AATT 1 cut(s) 126
SspMI CTAG 2 cut(s) 158, 167
StyD4I CCNGG 1 cut(s) 201
TasI AATT 1 cut(s) 126
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 141
XbaI TCTAGA 1 cut(s) 157
XspI CTAG 2 cut(s) 158, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.