Rh2BG518700

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
72742431 .. 72776318
33888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG518700.1

Sequence Viewer

Length: 228 bp
ATGGAAATTACCAATGATGTCAAGAGAGATGAAGTAGAGAAGCTCGTTAGGGAGTTAATGGAAGGAGAGAAGGGTAAGAAAATGAAGAGTAAGGTCATGGAGTGGAAGAAACTTGCGGAAGAAGCCACGGCTCCAGAGGGTTCTTCGTTCAAAAATTTGGACAATCTAGTGAACCAAGCAGAGAAGCACCAATTGAGAAACATGGGAGGCACACGCACAATCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.62

Weight (kDa)

7.99

Isoelectric Point (pI)

26.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AcsI RAATTY 1 cut(s) 154
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
ApoI RAATTY 1 cut(s) 154
BceAI ACGGC 1 cut(s) 144
BfaI CTAG 2 cut(s) 167, 226
BmiI GGNNCC 1 cut(s) 132
BpmI CTGGAG 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BspACI CCGC 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 126
Bst6I CTCTTC 1 cut(s) 80
BstDSI CCRYGG 1 cut(s) 126
BstMWI GCNNNNNNNGC 1 cut(s) 122
BtgI CCRYGG 1 cut(s) 126
CviAII CATG 2 cut(s) 97, 202
CviJI RGCY 3 cut(s) 43, 125, 131
CviKI_1 RGCY 3 cut(s) 43, 125, 131
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
FaeI CATG 2 cut(s) 100, 205
FaiI YATR 2 cut(s) 98, 203
FatI CATG 2 cut(s) 96, 201
FspBI CTAG 2 cut(s) 167, 226
GsuI CTGGAG 1 cut(s) 117
Hin1II CATG 2 cut(s) 100, 205
Hpy166II GTNNAC 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 22, 134
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 2 cut(s) 56, 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
Hsp92II CATG 2 cut(s) 100, 205
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 1 cut(s) 147
MaeI CTAG 2 cut(s) 167, 226
MboII GAAGA 4 cut(s) 97, 118, 131, 135
MfeI CAATTG 1 cut(s) 191
MluCI AATT 3 cut(s) 6, 154, 191
MnlI CCTC 2 cut(s) 130, 200
MseI TTAA 1 cut(s) 56
MunI CAATTG 1 cut(s) 191
MwoI GCNNNNNNNGC 1 cut(s) 122
NlaIII CATG 2 cut(s) 100, 205
NlaIV GGNNCC 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 56
SetI ASST 2 cut(s) 45, 96
SgeI CNNG 9 cut(s) 34, 56, 109, 125, 139, 146, 179, 188, 214
Sse9I AATT 3 cut(s) 6, 154, 191
SsiI CCGC 1 cut(s) 116
SspMI CTAG 2 cut(s) 167, 226
TasI AATT 3 cut(s) 6, 154, 191
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TspDTI ATGAA 2 cut(s) 45, 98
XapI RAATTY 1 cut(s) 154
XspI CTAG 2 cut(s) 167, 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.