Rh5BG203200

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
22964369 .. 22964865
497 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG203200.1

Sequence Viewer

Length: 234 bp
ATGGAGATCAACACTGATGTCAAGAGAGATAATGTGGAGAAGCTTGTAAAGGAGTTAATGGAGGGAGACAAGGGAAAGAAAATGAAAAGCAAGGCCTTGGAGTGGAAGAAACTAGCTGAAGAAGCCACTGCTCCGTATGGTTCGTCATCAACAAACTTGGACAATTTATTTAATGATTATAACAATCACACCAAGTACAATATTTATTCAATGATTGGTCAAAAATTGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.87

Weight (kDa)

7.9

Isoelectric Point (pI)

23.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 180
AcuI CTGAAG 1 cut(s) 138
AfaI GTAC 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 102
AgsI TTSAA 2 cut(s) 210, 229
AluBI AGCT 2 cut(s) 43, 116
AluI AGCT 2 cut(s) 43, 116
Alw26I GTCTC 1 cut(s) 60
AoxI GGCC 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 60
BfaI CTAG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 96
Bsc4I CCNNNNNNNGG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 102
BshFI GGCC 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 60
BsnI GGCC 1 cut(s) 95
Bsp143I GATC 1 cut(s) 6
BspANI GGCC 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 96
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 122
BsuRI GGCC 1 cut(s) 95
BtsI GCAGTG 1 cut(s) 126
BtsIMutI CAGTG 2 cut(s) 12, 126
Csp6I GTAC 1 cut(s) 196
CviJI RGCY 4 cut(s) 43, 95, 116, 125
CviKI_1 RGCY 4 cut(s) 43, 95, 116, 125
CviQI GTAC 1 cut(s) 196
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eco130I CCWWGG 1 cut(s) 96
Eco147I AGGCCT 1 cut(s) 95
Eco57I CTGAAG 1 cut(s) 138
EcoT14I CCWWGG 1 cut(s) 96
ErhI CCWWGG 1 cut(s) 96
FaiI YATR 2 cut(s) 138, 180
FspBI CTAG 1 cut(s) 113
HaeIII GGCC 1 cut(s) 95
HindIII AAGCTT 1 cut(s) 41
Hpy188III TCNNGA 1 cut(s) 22
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 136
MaeI CTAG 1 cut(s) 113
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 118, 131
MluCI AATT 2 cut(s) 163, 224
MnlI CCTC 1 cut(s) 55
MseI TTAA 2 cut(s) 56, 171
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 1 cut(s) 6
PceI AGGCCT 1 cut(s) 95
PsiI TTATAA 1 cut(s) 180
RsaI GTAC 1 cut(s) 197
RsaNI GTAC 1 cut(s) 196
SaqAI TTAA 2 cut(s) 56, 171
Sau3AI GATC 1 cut(s) 6
SetI ASST 2 cut(s) 45, 118
SgeI CNNG 8 cut(s) 34, 56, 82, 103, 109, 125, 169, 205
Sse9I AATT 2 cut(s) 163, 224
SseBI AGGCCT 1 cut(s) 95
SspI AATATT 1 cut(s) 202
SspMI CTAG 1 cut(s) 113
StuI AGGCCT 1 cut(s) 95
StyI CCWWGG 1 cut(s) 96
TasI AATT 2 cut(s) 163, 224
TatI WGTACW 1 cut(s) 195
Tru1I TTAA 2 cut(s) 56, 171
Tru9I TTAA 2 cut(s) 56, 171
TscAI CASTG 2 cut(s) 19, 133
TspDTI ATGAA 1 cut(s) 98
TspGWI ACGGA 1 cut(s) 123
TspRI CASTG 2 cut(s) 19, 133
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.