Rh2BG519200

UDP-Glycosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
72826043 .. 72826240
198 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG519200.1

Sequence Viewer

Length: 198 bp
ATGGAAATTACCAATGATGTCAAGAGAGAAGAAGTAGAGAAGCTTGTTAGGGAGTTAATGGAAGGAGAGAAGGGTAAGAAAATGAAGAGCAAGGTCATGGAGTGGAAGAAACTTGTGGAAGAAGCCACGGCTCCAGAGGGTTCTTCGTTCAAAAATTTGGACAATCTAGTGAACCACGTTCTACTGCAGAAAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.53

Weight (kDa)

6.59

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 154
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
ApoI RAATTY 1 cut(s) 154
BceAI ACGGC 1 cut(s) 144
BfaI CTAG 1 cut(s) 167
BfmI CTRYAG 1 cut(s) 185
BmiI GGNNCC 1 cut(s) 132
BpmI CTGGAG 1 cut(s) 117
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 132
BspMAI CTGCAG 1 cut(s) 189
BspQI GCTCTTC 1 cut(s) 80
BssECI CCNNGG 1 cut(s) 126
Bst6I CTCTTC 1 cut(s) 80
BstDSI CCRYGG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 185
BtgI CCRYGG 1 cut(s) 126
CviAII CATG 1 cut(s) 97
CviJI RGCY 3 cut(s) 43, 125, 131
CviKI_1 RGCY 3 cut(s) 43, 125, 131
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
FaeI CATG 1 cut(s) 100
FaiI YATR 1 cut(s) 98
FatI CATG 1 cut(s) 96
FspBI CTAG 1 cut(s) 167
GsuI CTGGAG 1 cut(s) 117
Hin1II CATG 1 cut(s) 100
HindIII AAGCTT 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 22, 134
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 2 cut(s) 56, 64
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 187
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 1 cut(s) 100
LguI GCTCTTC 1 cut(s) 80
LmnI GCTCC 1 cut(s) 136
LpnPI CCDG 1 cut(s) 147
MaeI CTAG 1 cut(s) 167
MaeII ACGT 1 cut(s) 177
MboII GAAGA 5 cut(s) 41, 97, 118, 131, 135
MluCI AATT 2 cut(s) 6, 154
MnlI CCTC 1 cut(s) 130
MseI TTAA 2 cut(s) 56, 196
NlaIII CATG 1 cut(s) 100
NlaIV GGNNCC 1 cut(s) 132
PciSI GCTCTTC 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 132
PstI CTGCAG 1 cut(s) 189
SapI GCTCTTC 1 cut(s) 80
SaqAI TTAA 2 cut(s) 56, 196
SetI ASST 3 cut(s) 45, 96, 180
SfcI CTRYAG 1 cut(s) 185
SgeI CNNG 9 cut(s) 34, 56, 103, 109, 125, 139, 146, 179, 188
Sse9I AATT 2 cut(s) 6, 154
SspMI CTAG 1 cut(s) 167
TaiI ACGT 1 cut(s) 180
TasI AATT 2 cut(s) 6, 154
Tru1I TTAA 2 cut(s) 56, 196
Tru9I TTAA 2 cut(s) 56, 196
TspDTI ATGAA 1 cut(s) 98
XapI RAATTY 1 cut(s) 154
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.