MD11G1140200.v1.1

Seed storage protein. Accumulates during seed development and is hydrolyzed after germination to provide a carbon and nitrogen source for the developing seedling

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
13021379 .. 13024746
3368 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1140200.v1.1.491

Sequence Viewer

Length: 237 bp
ATGAAAAGAAGAGAACAATGTGTTTGTACGCTTCTGATTAAACACAAAAAGAAGTCCTTCAACATGGAACATGAAGATGTAATTGAAGTTTCTACAGAAGCTACTAAATACTTAATTAACAATGACAATGATGTATCCCTTTACATTGCAAAGCTCATCCCCTCCGTTAGCAATTCTGGACAATTTGAAGTAACATCATCAGTTCATTTTATCAATTTTATTTGTTTGAGCGATTAA

Protein Analysis

79

Amino Acids

8.95

Weight (kDa)

6.26

Isoelectric Point (pI)

38.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 28
AgsI TTSAA 3 cut(s) 61, 86, 188
AluBI AGCT 2 cut(s) 101, 154
AluI AGCT 2 cut(s) 101, 154
Asp700I GAANNNNTTC 1 cut(s) 56
BciVI GTATCC 1 cut(s) 145
BfmI CTRYAG 1 cut(s) 93
BfuI GTATCC 1 cut(s) 145
Bse3DI GCAATG 1 cut(s) 144
BseGI GGATG 1 cut(s) 156
BseMI GCAATG 1 cut(s) 144
BsrDI GCAATG 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 156
BstSFI CTRYAG 1 cut(s) 93
BsuI GTATCC 1 cut(s) 145
BtsCI GGATG 1 cut(s) 156
Csp6I GTAC 1 cut(s) 27
CviAII CATG 2 cut(s) 64, 71
CviJI RGCY 2 cut(s) 101, 154
CviKI_1 RGCY 2 cut(s) 101, 154
CviQI GTAC 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 4
EarI CTCTTC 1 cut(s) 4
FaeI CATG 2 cut(s) 67, 74
FaiI YATR 2 cut(s) 65, 72
FalI AAGNNNNNCTT 2 cut(s) 41, 73
FatI CATG 2 cut(s) 63, 70
FokI GGATG 1 cut(s) 143
FspEI CC 9 cut(s) 50, 70, 151, 152, 162, 173, 174, 175, 178
Hin1II CATG 2 cut(s) 67, 74
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 177
HpyAV CCTTC 1 cut(s) 67
HpyCH4V TGCA 1 cut(s) 149
Hsp92II CATG 2 cut(s) 67, 74
LpnPI CCDG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 190
MboII GAAGA 2 cut(s) 21, 86
MluCI AATT 5 cut(s) 81, 114, 172, 182, 214
MnlI CCTC 1 cut(s) 172
MroXI GAANNNNTTC 1 cut(s) 56
MseI TTAA 4 cut(s) 39, 113, 117, 235
MslI CAYNNNNRTG 1 cut(s) 75
NlaIII CATG 2 cut(s) 67, 74
PacI TTAATTAA 1 cut(s) 117
PdmI GAANNNNTTC 1 cut(s) 56
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 4 cut(s) 39, 113, 117, 235
SetI ASST 2 cut(s) 103, 156
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 3 cut(s) 76, 83, 189
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 5 cut(s) 81, 114, 172, 182, 214
TasI AATT 5 cut(s) 81, 114, 172, 182, 214
Tru1I TTAA 4 cut(s) 39, 113, 117, 235
Tru9I TTAA 4 cut(s) 39, 113, 117, 235
TspDTI ATGAA 3 cut(s) 17, 87, 194
TspGWI ACGGA 1 cut(s) 154
XmnI GAANNNNTTC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.