Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007625.1

Orthogroup ID

OG0002332

Physical Location & Seq

Genomic Coordinates Reverse (-)

2389 .. 4221

Gene Structure 1833 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007625.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1662 bp

atgacacgtaaatcggacactcgtcacaatgcatggcctcaaccctcctcttatcgaattatcttcaccttgcttattatatatatagcatttccacgatcgtctacttcatcaagaactgaaaacatggagttgaaaagtaagctttgtttggttgtcttgctcttttctgttttgcttgctgtgagtgctagtctggactataaggagagagaccctgagctgaagcagtgcaagcaccagtgcaaacaccagagaggatatgatgagcaagacaagcaactctgcgagcagcgatgcgatgactacatcaagcagaagaggcaggaagagaagcagcgaaggacagaaggaggagaaggtactagtttttatagatatgacgaggatcagtatgagggtcagggccaacaacaacaggaccagaatccctacttgtttgaagatcaggatttcgagacccaaattgaaacagatcaaggccgagttcagattcttcagaagttcactgacaagtctgatcttctgcgcggcattgagaatttccggattggttctcttgtcaccaagcctcactcttttgttgctccacaccatcacgatgctgactgtgttctcttcgtcttccaggggcgaccaaccattactatggtgagaggggagaagagagagagccataaccttgaacgtggagacatactcagggttccagctggtacacctgtttatattatcaatagagacggtaatgaaaagctgtttgttgtgaaactcctccacccagtctcccttcctgatcagtttgagacattttatgagggaggtggtgaaaatccagaatcatttttcaaagctttcagtccggaggtacttcaagcggctttcaagactgaaagagatgagctggagaggctattcgggcagcagaggcaaggcagcatcatgaaggcctccagagagcaaattgagaagatgagccacagtactcgtggccgtgaaggattttggcctttccatggtgatgaaccatcaacaccattttcaacatcatcatcgaaatcaggcccattcaatctcttcaaaaagcggccttctcagtcaaaccgacacggacgtctctttgaagccgattccaatgactacaaacagctcgaggagctcgacctccaaatcttttttgctaacattactcgagggtccatgactgctccattcttcaactccaaagccaccaagattgcctttgttttggatggtgagggcttcttcgagatggcctgcccgcaccttgcttcccaaggaagctcccaacaccaacagcaacgtcagcggaggagcagcagcccaagctaccagaatgtaagaggggacttgagacgcggtaccgtttttattgtgccggctggccatccggtgactgccattgcctcgagcaacaataacctacaagtcatctgctttgaggtgaatgcgaaagacaatgtgaggttccctctgactggaaagaagaatgtggtgagtctgtttgagagggacgcaaaggagttggcattcggtgttccggtgagagaggtggaccgcatctttaacaagcaagatggcgagtttttcctggagggaccgaacaatcagcagcagggtcgtatgtggtcagtggtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005575 GO:0016020 GO:0019863 GO:0019865 GO:0044877

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cupin_1

Protein Analysis

553

Amino Acids

63.59

Weight (kDa)

7.25

Isoelectric Point (pI)

52.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002332)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22640
fragaria_vesca	FvH4_2g23190 FvH4_4g15931 FvH4_4g15931
malus_domestica	MD03G1261200.v1.1 MD11G1140200.v1.1 MD11G1281600.v1.1 MD13G1196800.v1.1 MD16G1197100.v1.1 MD16G1197200.v1.1
prunus_persica	Prupe.1G017700_v2.0.a1 Prupe.1G018000_v2.0.a1 Prupe.8G237500_v2.0.a1
pyrus_communis	pycom09g17330 pycom11g24970 pycom13g16920 pycom13g16930 pycom16g16590 pycom16g16620
rosa_chinensis	RchiOBHm_Chr4g0415511 RchiOBHm_Chr6g0290441
rosa_laevigata	RLG00000008067 RLG00000012215
rosa_multiflora	Rmu_sc0002890.1_g000006 Rmu_sc0007265.1_g000001 Rmu_sc0007625.1_g000002 Rmu_sc0020894.1_g000005 Rmu_sc0020894.1_g000006
rosa_roxburghii	Rroxscaffold_5G00359290 Rroxscaffold_7G00177060
rosa_rugosa	Rorug04G0134600 Rorug06G0212700
rosa_samantha	Rh4AG195500 Rh4BG194300 Rh4CG206400 Rh4DG193300 Rh6AG322900 Rh6BG330300 Rh6CG336400 Rh6DG323300
rosa_wichuraiana	Rw4G016650 Rw6G027990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1113
AatII	GACGTC	1 cut(s)	1117
Acc65I	GGTACC	1 cut(s)	1382
AccB1I	GGYRCC	1 cut(s)	1382
AccI	GTMKAC	1 cut(s)	104
AccII	CGCG	2 cut(s)	531, 1380
AccIII	TCCGGA	2 cut(s)	546, 862
AciI	CCGC	7 cut(s)	531, 878, 1087, 1283, 1330, 1380, 1579
AclWI	GGATC	1 cut(s)	396
AcoI	YGGCCR	2 cut(s)	991, 1405
AcsI	RAATTY	1 cut(s)	541
AcuI	CTGAAG	2 cut(s)	245, 482
AcyI	GRCGYC	1 cut(s)	1114
AfaI	GTAC	5 cut(s)	364, 718, 870, 985, 1384
AfiI	CCNNNNNNNGG	2 cut(s)	1016, 1499
AflIII	ACRYGT	1 cut(s)	5
AhlI	ACTAGT	1 cut(s)	365
AjnI	CCWGG	2 cut(s)	627, 1611
Alw21I	GWGCWC	1 cut(s)	1161
Alw26I	GTCTC	8 cut(s)	207, 452, 687, 735, 790, 800, 1121, 1369
AlwI	GGATC	1 cut(s)	396
Ama87I	CYCGRG	3 cut(s)	1151, 1191, 1429
Aor13HI	TCCGGA	2 cut(s)	546, 862
ApeKI	GCWGC	7 cut(s)	292, 337, 922, 936, 1338, 1341, 1633
ApoI	RAATTY	1 cut(s)	541
Asp718I	GGTACC	1 cut(s)	1382
AspLEI	GCGC	1 cut(s)	531
AspS9I	GGNCC	6 cut(s)	406, 421, 1064, 1197, 1576, 1619
AvaI	CYCGRG	3 cut(s)	1151, 1191, 1429
AvaII	GGWCC	4 cut(s)	421, 1197, 1576, 1619
BaeI	ACNNNNGTAYC	2 cut(s)	708, 741
BalI	TGGCCA	1 cut(s)	1407
BanI	GGYRCC	1 cut(s)	1382
BanII	GRGCYC	1 cut(s)	1161
BauI	CACGAG	1 cut(s)	987
BbsI	GAAGAC	1 cut(s)	616
Bbv12I	GWGCWC	1 cut(s)	1161
BbvI	GCAGC	7 cut(s)	304, 349, 934, 948, 1350, 1353, 1645
BccI	CCATC	6 cut(s)	603, 1036, 1247, 1267, 1416, 1592
BceAI	ACGGC	1 cut(s)	978
BcgI	CGANNNNNNTGC	2 cut(s)	1622, 1656
BciT130I	CCWGG	2 cut(s)	629, 1613
BclI	TGATCA	1 cut(s)	796
BcoDI	GTCTC	8 cut(s)	207, 452, 687, 735, 790, 800, 1121, 1369
BcuI	ACTAGT	1 cut(s)	365
BfaI	CTAG	2 cut(s)	192, 366
BmcAI	AGTACT	1 cut(s)	985
Bme1390I	CCNGG	2 cut(s)	629, 1613
Bme18I	GGWCC	4 cut(s)	421, 1197, 1576, 1619
BmeT110I	CYCGRG	3 cut(s)	1151, 1191, 1429
BmgT120I	GGNCC	6 cut(s)	406, 421, 1064, 1197, 1576, 1619
BmiI	GGNNCC	5 cut(s)	708, 1198, 1384, 1490, 1620
BmrFI	CCNGG	2 cut(s)	629, 1613
BmrI	ACTGGG	1 cut(s)	776
BmsI	GCATC	4 cut(s)	287, 592, 948, 1590
BmuI	ACTGGG	1 cut(s)	776
BoxI	GACNNNNGTC	1 cut(s)	21
BpiI	GAAGAC	1 cut(s)	616
BplI	GAGNNNNNCTC	4 cut(s)	684, 716, 1477, 1509
BpmI	CTGGAG	3 cut(s)	926, 937, 1634
Bpu10I	CCTNAGC	1 cut(s)	219
BpuEI	CTTGAG	1 cut(s)	1393
BsaAI	YACGTR	1 cut(s)	8
BsaHI	GRCGYC	1 cut(s)	1114
BsaI	GGTCTC	2 cut(s)	207, 452
BsaJI	CCNNGG	3 cut(s)	628, 1015, 1297
BsaWI	WCCGGW	4 cut(s)	546, 862, 1411, 1561
BsaXI	ACNNNNNCTCC	2 cut(s)	770, 800
Bsc4I	CCNNNNNNNGG	2 cut(s)	1016, 1499
Bse118I	RCCGGY	1 cut(s)	1399
Bse1I	ACTGG	3 cut(s)	241, 782, 1504
Bse3DI	GCAATG	1 cut(s)	1422
BseAI	TCCGGA	2 cut(s)	546, 862
BseBI	CCWGG	2 cut(s)	629, 1613
BseDI	CCNNGG	3 cut(s)	628, 1015, 1297
BseGI	GGATG	2 cut(s)	1258, 1408
BseLI	CCNNNNNNNGG	2 cut(s)	1016, 1499
BseMI	GCAATG	1 cut(s)	1422
BseMII	CTCAG	3 cut(s)	210, 715, 1109
BseNI	ACTGG	3 cut(s)	241, 782, 1504
BseRI	GAGGAG	5 cut(s)	37, 369, 764, 1169, 1348
BseXI	GCAGC	7 cut(s)	304, 349, 934, 948, 1350, 1353, 1645
Bsh1236I	CGCG	2 cut(s)	531, 1380
Bsh1285I	CGRYCG	1 cut(s)	101
BshNI	GGYRCC	1 cut(s)	1382
BsiEI	CGRYCG	1 cut(s)	101
BsiHKAI	GWGCWC	1 cut(s)	1161
BsiHKCI	CYCGRG	3 cut(s)	1151, 1191, 1429
BsiSI	CCGG	5 cut(s)	547, 863, 1400, 1412, 1562
BslFI	GGGAC	3 cut(s)	1382, 1547, 1632
BslI	CCNNNNNNNGG	2 cut(s)	1016, 1499
BsmAI	GTCTC	8 cut(s)	207, 452, 687, 735, 790, 800, 1121, 1369
BsmBI	CGTCTC	3 cut(s)	735, 1121, 1369
BsmFI	GGGAC	3 cut(s)	1382, 1547, 1632
BsmI	GAATGC	2 cut(s)	1474, 1550
Bso31I	GGTCTC	2 cut(s)	207, 452
BsoBI	CYCGRG	3 cut(s)	1151, 1191, 1429
Bsp1286I	GDGCHC	1 cut(s)	1161
Bsp13I	TCCGGA	2 cut(s)	546, 862
Bsp143I	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
Bsp19I	CCATGG	1 cut(s)	1015
BspACI	CCGC	7 cut(s)	531, 878, 1087, 1283, 1330, 1380, 1579
BspCNI	CTCAG	3 cut(s)	211, 714, 1108
BspEI	TCCGGA	2 cut(s)	546, 862
BspFNI	CGCG	2 cut(s)	531, 1380
BspHI	TCATGA	1 cut(s)	942
BspLI	GGNNCC	5 cut(s)	708, 1198, 1384, 1490, 1620
BspPI	GGATC	1 cut(s)	396
BspT107I	GGYRCC	1 cut(s)	1382
BspTNI	GGTCTC	2 cut(s)	207, 452
BsrDI	GCAATG	1 cut(s)	1422
BsrFI	RCCGGY	1 cut(s)	1399
BsrI	ACTGG	3 cut(s)	241, 782, 1504
BssAI	RCCGGY	1 cut(s)	1399
BssECI	CCNNGG	3 cut(s)	628, 1015, 1297
BssMI	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
BssNI	GRCGYC	1 cut(s)	1114
BssSI	CACGAG	1 cut(s)	987
BssT1I	CCWWGG	2 cut(s)	1015, 1297
Bst2BI	CACGAG	1 cut(s)	987
Bst2UI	CCWGG	2 cut(s)	629, 1613
Bst4CI	ACNGT	4 cut(s)	611, 746, 983, 1387
Bst6I	CTCTTC	5 cut(s)	314, 324, 623, 659, 1082
BstACI	GRCGYC	1 cut(s)	1114
BstBAI	YACGTR	1 cut(s)	8
BstC8I	GCNNGC	7 cut(s)	180, 236, 290, 1279, 1283, 1401, 1405
BstDEI	CTNAG	3 cut(s)	219, 701, 1095
BstDSI	CCRYGG	1 cut(s)	1015
BstF5I	GGATG	2 cut(s)	1258, 1408
BstFNI	CGCG	2 cut(s)	531, 1380
BstHHI	GCGC	1 cut(s)	531
BstKTI	GATC	6 cut(s)	101, 391, 448, 478, 523, 799
BstMAI	GTCTC	8 cut(s)	207, 452, 687, 735, 790, 800, 1121, 1369
BstMBI	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
BstMCI	CGRYCG	1 cut(s)	101
BstNI	CCWGG	2 cut(s)	629, 1613
BstPAI	GACNNNNGTC	1 cut(s)	21
BstSCI	CCNGG	2 cut(s)	627, 1611
BstUI	CGCG	2 cut(s)	531, 1380
BstV1I	GCAGC	7 cut(s)	304, 349, 934, 948, 1350, 1353, 1645
BstV2I	GAAGAC	1 cut(s)	616
BstXI	CCANNNNNNTGG	1 cut(s)	649
BtgI	CCRYGG	1 cut(s)	1015
BtgZI	GCGATG	2 cut(s)	310, 315
BtsCI	GGATG	2 cut(s)	1258, 1408
BtsI	GCAGTG	1 cut(s)	236
BtsIMutI	CAGTG	4 cut(s)	236, 248, 507, 1659
Cac8I	GCNNGC	7 cut(s)	180, 236, 290, 1279, 1283, 1401, 1405
CciI	TCATGA	1 cut(s)	942
CfoI	GCGC	1 cut(s)	531
Cfr10I	RCCGGY	1 cut(s)	1399
Cfr13I	GGNCC	6 cut(s)	406, 421, 1064, 1197, 1576, 1619
CseI	GACGC	2 cut(s)	1386, 1544
Csp6I	GTAC	5 cut(s)	363, 717, 869, 984, 1383
CspCI	CAANNNNNGTGG	2 cut(s)	1219, 1254
CviAII	CATG	5 cut(s)	33, 127, 943, 1016, 1201
CviQI	GTAC	5 cut(s)	363, 717, 869, 984, 1383
DdeI	CTNAG	3 cut(s)	219, 701, 1095
DpnI	GATC	6 cut(s)	100, 390, 447, 477, 522, 798
DpnII	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
DrdI	GACNNNNNNGTC	1 cut(s)	1113
DseDI	GACNNNNNNGTC	1 cut(s)	1113
EaeI	YGGCCR	2 cut(s)	991, 1405
Eam1104I	CTCTTC	5 cut(s)	314, 324, 623, 659, 1082
EarI	CTCTTC	5 cut(s)	314, 324, 623, 659, 1082
Ecl136II	GAGCTC	1 cut(s)	1159
Eco130I	CCWWGG	2 cut(s)	1015, 1297
Eco147I	AGGCCT	1 cut(s)	950
Eco24I	GRGCYC	1 cut(s)	1161
Eco31I	GGTCTC	2 cut(s)	207, 452
Eco47I	GGWCC	4 cut(s)	421, 1197, 1576, 1619
Eco53kI	GAGCTC	1 cut(s)	1159
Eco57I	CTGAAG	2 cut(s)	245, 482
Eco88I	CYCGRG	3 cut(s)	1151, 1191, 1429
EcoICRI	GAGCTC	1 cut(s)	1159
EcoRII	CCWGG	2 cut(s)	627, 1611
EcoT14I	CCWWGG	2 cut(s)	1015, 1297
EcoT22I	ATGCAT	1 cut(s)	34
EcoT38I	GRGCYC	1 cut(s)	1161
ErhI	CCWWGG	2 cut(s)	1015, 1297
Esp3I	CGTCTC	3 cut(s)	735, 1121, 1369
FaeI	CATG	5 cut(s)	36, 130, 946, 1019, 1204
FalI	AAGNNNNNCTT	2 cut(s)	1226, 1258
FaqI	GGGAC	3 cut(s)	1382, 1547, 1632
FatI	CATG	5 cut(s)	32, 126, 942, 1015, 1200
FauI	CCCGC	1 cut(s)	1290
FbaI	TGATCA	1 cut(s)	796
FblI	GTMKAC	1 cut(s)	104
FokI	GGATG	2 cut(s)	1265, 1395
FriOI	GRGCYC	1 cut(s)	1161
FspBI	CTAG	2 cut(s)	192, 366
GlaI	GCGC	1 cut(s)	530
GsuI	CTGGAG	3 cut(s)	926, 937, 1634
HapII	CCGG	5 cut(s)	547, 863, 1400, 1412, 1562
HgaI	GACGC	2 cut(s)	1386, 1544
HhaI	GCGC	1 cut(s)	531
Hin1I	GRCGYC	1 cut(s)	1114
Hin1II	CATG	5 cut(s)	36, 130, 946, 1019, 1204
Hin6I	GCGC	1 cut(s)	529
HinP1I	GCGC	1 cut(s)	529
HindIII	AAGCTT	2 cut(s)	143, 852
HinfI	GANTC	5 cut(s)	427, 493, 839, 1130, 1519
HpaII	CCGG	5 cut(s)	547, 863, 1400, 1412, 1562
Hpy166II	GTNNAC	4 cut(s)	105, 507, 719, 1576
Hpy188I	TCNGA	5 cut(s)	16, 492, 501, 520, 1497
Hpy8I	GTNNAC	4 cut(s)	105, 507, 719, 1576
HpyAV	CCTTC	7 cut(s)	336, 344, 353, 800, 940, 992, 1101
HpyCH4III	ACNGT	4 cut(s)	611, 746, 983, 1387
HpyCH4IV	ACGT	4 cut(s)	7, 688, 1114, 1324
HpyCH4V	TGCA	3 cut(s)	32, 234, 246
HpyF3I	CTNAG	3 cut(s)	219, 701, 1095
HpySE526I	ACGT	4 cut(s)	7, 688, 1114, 1324
Hsp92I	GRCGYC	1 cut(s)	1114
Hsp92II	CATG	5 cut(s)	36, 130, 946, 1019, 1204
HspAI	GCGC	1 cut(s)	529
Kpn2I	TCCGGA	2 cut(s)	546, 862
KpnI	GGTACC	1 cut(s)	1386
KroI	GCCGGC	1 cut(s)	1399
KroNI	GCCGGC	1 cut(s)	1401
Ksp22I	TGATCA	1 cut(s)	796
Kzo9I	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
LmnI	GCTCC	5 cut(s)	592, 1156, 1213, 1310, 1335
Lsp1109I	GCAGC	7 cut(s)	304, 349, 934, 948, 1350, 1353, 1645
LweI	GCATC	4 cut(s)	287, 592, 948, 1590
MaeI	CTAG	2 cut(s)	192, 366
MaeII	ACGT	4 cut(s)	7, 688, 1114, 1324
MaeIII	GTNAC	3 cut(s)	23, 562, 1414
MalI	GATC	6 cut(s)	100, 390, 447, 477, 522, 798
MboI	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
MhlI	GDGCHC	1 cut(s)	1161
MlsI	TGGCCA	1 cut(s)	1407
MluCI	AATT	4 cut(s)	57, 465, 541, 963
MluNI	TGGCCA	1 cut(s)	1407
MlyI	GAGTC	1 cut(s)	1528
Mox20I	TGGCCA	1 cut(s)	1407
Mph1103I	ATGCAT	1 cut(s)	34
MroI	TCCGGA	2 cut(s)	546, 862
MroNI	GCCGGC	1 cut(s)	1399
MscI	TGGCCA	1 cut(s)	1407
MseI	TTAA	1 cut(s)	1587
MslI	CAYNNNNRTG	3 cut(s)	600, 647, 1020
Msp20I	TGGCCA	1 cut(s)	1407
MspA1I	CMGCKG	2 cut(s)	713, 1330
MspI	CCGG	5 cut(s)	547, 863, 1400, 1412, 1562
MspR9I	CCNGG	2 cut(s)	629, 1613
Mva1269I	GAATGC	2 cut(s)	1474, 1550
MvaI	CCWGG	2 cut(s)	629, 1613
MvnI	CGCG	2 cut(s)	531, 1380
NaeI	GCCGGC	1 cut(s)	1401
NcoI	CCATGG	1 cut(s)	1015
NdeII	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
NgoMIV	GCCGGC	1 cut(s)	1399
NlaIII	CATG	5 cut(s)	36, 130, 946, 1019, 1204
NlaIV	GGNNCC	5 cut(s)	708, 1198, 1384, 1490, 1620
NmeAIII	GCCGAG	1 cut(s)	509
NmuCI	GTSAC	3 cut(s)	23, 562, 1414
NsiI	ATGCAT	1 cut(s)	34
PaeR7I	CTCGAG	3 cut(s)	1151, 1191, 1429
PagI	TCATGA	1 cut(s)	942
PceI	AGGCCT	1 cut(s)	950
PcsI	WCGNNNNNNNCGW	1 cut(s)	1158
PctI	GAATGC	2 cut(s)	1474, 1550
PdiI	GCCGGC	1 cut(s)	1401
PfeI	GAWTC	4 cut(s)	427, 493, 839, 1130
PfoI	TCCNGGA	1 cut(s)	1611
Ple19I	CGATCG	1 cut(s)	101
PleI	GAGTC	1 cut(s)	1527
PpsI	GAGTC	1 cut(s)	1527
Ppu21I	YACGTR	1 cut(s)	8
PshAI	GACNNNNGTC	1 cut(s)	21
Psp124BI	GAGCTC	1 cut(s)	1161
Psp6I	CCWGG	2 cut(s)	627, 1611
PspGI	CCWGG	2 cut(s)	627, 1611
PspN4I	GGNNCC	5 cut(s)	708, 1198, 1384, 1490, 1620
PspPI	GGNCC	6 cut(s)	406, 421, 1064, 1197, 1576, 1619
PspXI	VCTCGAGB	3 cut(s)	1151, 1191, 1429
PvuI	CGATCG	1 cut(s)	101
PvuII	CAGCTG	1 cut(s)	713
RsaI	GTAC	5 cut(s)	364, 718, 870, 985, 1384
RsaNI	GTAC	5 cut(s)	363, 717, 869, 984, 1383
RseI	CAYNNNNRTG	3 cut(s)	600, 647, 1020
SacI	GAGCTC	1 cut(s)	1161
SaqAI	TTAA	1 cut(s)	1587
Sau3AI	GATC	6 cut(s)	98, 388, 445, 475, 520, 796
Sau96I	GGNCC	6 cut(s)	406, 421, 1064, 1197, 1576, 1619
ScaI	AGTACT	1 cut(s)	985
SchI	GAGTC	1 cut(s)	1528
ScrFI	CCNGG	2 cut(s)	629, 1613
SduI	GDGCHC	1 cut(s)	1161
SfaNI	GCATC	4 cut(s)	287, 592, 948, 1590
Sfr274I	CTCGAG	3 cut(s)	1151, 1191, 1429
SinI	GGWCC	4 cut(s)	421, 1197, 1576, 1619
SlaI	CTCGAG	3 cut(s)	1151, 1191, 1429
SmiMI	CAYNNNNRTG	3 cut(s)	600, 647, 1020
SmlI	CTYRAG	4 cut(s)	1151, 1191, 1372, 1429
SmoI	CTYRAG	4 cut(s)	1151, 1191, 1372, 1429
SpeI	ACTAGT	1 cut(s)	365
Sse9I	AATT	4 cut(s)	57, 465, 541, 963
SseBI	AGGCCT	1 cut(s)	950
SsiI	CCGC	7 cut(s)	531, 878, 1087, 1283, 1330, 1380, 1579
SspMI	CTAG	2 cut(s)	192, 366
SstI	GAGCTC	1 cut(s)	1161
StuI	AGGCCT	1 cut(s)	950
StyD4I	CCNGG	2 cut(s)	627, 1611
StyI	CCWWGG	2 cut(s)	1015, 1297
TaaI	ACNGT	4 cut(s)	611, 746, 983, 1387
TaiI	ACGT	4 cut(s)	10, 691, 1117, 1327
TaqI	TCGA	8 cut(s)	55, 456, 1055, 1152, 1161, 1192, 1269, 1430
TaqII	GACCGA	1 cut(s)	1636
TasI	AATT	4 cut(s)	57, 465, 541, 963
TatI	WGTACW	1 cut(s)	983
TauI	GCSGC	3 cut(s)	534, 881, 1090
TfiI	GAWTC	4 cut(s)	427, 493, 839, 1130
Tru1I	TTAA	1 cut(s)	1587
Tru9I	TTAA	1 cut(s)	1587
TscAI	CASTG	4 cut(s)	236, 248, 514, 1659
TseFI	GTSAC	3 cut(s)	23, 562, 1414
TseI	GCWGC	7 cut(s)	292, 337, 922, 936, 1338, 1341, 1633
Tsp45I	GTSAC	3 cut(s)	23, 562, 1414
TspDTI	ATGAA	4 cut(s)	99, 765, 959, 1038
TspGWI	ACGGA	1 cut(s)	1125
TspRI	CASTG	4 cut(s)	236, 248, 514, 1659
VpaK11BI	GGWCC	4 cut(s)	421, 1197, 1576, 1619
XapI	RAATTY	1 cut(s)	541
XcmI	CCANNNNNNNNNTGG	1 cut(s)	986
XhoI	CTCGAG	3 cut(s)	1151, 1191, 1429
XmiI	GTMKAC	1 cut(s)	104
XspI	CTAG	2 cut(s)	192, 366
ZraI	GACGTC	1 cut(s)	1115
ZrmI	AGTACT	1 cut(s)	985
Zsp2I	ATGCAT	1 cut(s)	34

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.