Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002890.1

Orthogroup ID

OG0002332

Physical Location & Seq

Genomic Coordinates Reverse (-)

36078 .. 37946

Gene Structure 1869 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002890.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1698 bp

atggagacgataatggtcatcacccaaaccccaataatgacacgtaaatcggacactcgtcacaatgcatggcctcaaccctcctcttatcgaattatcttcaccttgcttattatatatatagcatttccacgatcgtctacttcatcaagaactgaaaacatggagttgaaaagtaagctttgtttggttgtcttgctcttttctgttttgcttgctgtgagtgctagtctggactataaggagagagaccctgagctgaagcagtgcaagcaccagtgcaaacaccagagaggatatgatgagcaagacaagcaactctgcgagcagcgatgcgatgactacatcaagcagaagaggcaggaagagaagcagcgaaggacagaaggaggagaaggtactagtttttatagatatgacgaggatcagtatgagggtcagggccaacaacaacaggaccagaatccctacttgtttgaagatcaggatttcgagacccaaattgaaacagatcaaggccgagttcagattcttcagaagttcactgacaagtctgatcttctgcgcggcattgagaatttccggattggttctcttgtcaccaagcctcactcttttgttgctccacaccatcacgatgctgactgtgttctcttcgtcttccaggggcgaccaaccattactatggtgagaggggagaagagagagagccataaccttgaacgtggagacatactcagggttccagctggtacacctgtttatattatcaatagagacggtaatgaaaagctgtttgttgtgaaactcctccacccagtctcccttcctgatcagtttgagacattttatgagggaggtggtgaaaatccagaatcatttttcaaagctttcagtccggaggtacttcaagcggctttcaagactgaaagagatgagctggagaggctattcgggcagcagaggcaaggcagcatcatgaaggcctccagagagcaaattgagaagatgagccacagtactcgtggccgtgaaggattttggcctttccatggtgatgaaccatcaacaccattttcaacatcatcatcgaaatcaggcccattcaatctcttcaaaaagcggccttctcagtcaaaccgacacggacgtctctttgaagccgattccaatgactacaaacagctcgaggagctcgacctccaaatcttttttgctaacattactcgagggtccatgactgctccattcttcaactccaaagccaccaagattgcctttgttttggatggtgagggcttcttcgagatggcctgcccccaccttgcttcccaaggaagctcccaacaccaacagcaacgtcagcggaggagcagcagcccaagctaccagaatgtaagaggggacttgagacgcggtaccgtttttattgtgccggctggccatccggtgactgccattgcctcgagcaacaataacctacaagtcatctgctttgaggtgaatgcgaaagacaatgtgaggttccctctgactggaaagaagaatgtggtgagtctgtttgagagggacgcaaaggagttggcattcggtgttccggtgagagaggtggaccgcatctttaacaagcaagatggcgagtttttcctggagggaccgaacaatcagcagcagggtcgtatgtggtcagtggtttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005575 GO:0016020 GO:0019863 GO:0019865 GO:0044877

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cupin_1

Protein Analysis

565

Amino Acids

64.95

Weight (kDa)

6.96

Isoelectric Point (pI)

51.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002332)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G22640
fragaria_vesca	FvH4_2g23190 FvH4_4g15931 FvH4_4g15931
malus_domestica	MD03G1261200.v1.1 MD11G1140200.v1.1 MD11G1281600.v1.1 MD13G1196800.v1.1 MD16G1197100.v1.1 MD16G1197200.v1.1
prunus_persica	Prupe.1G017700_v2.0.a1 Prupe.1G018000_v2.0.a1 Prupe.8G237500_v2.0.a1
pyrus_communis	pycom09g17330 pycom11g24970 pycom13g16920 pycom13g16930 pycom16g16590 pycom16g16620
rosa_chinensis	RchiOBHm_Chr4g0415511 RchiOBHm_Chr6g0290441
rosa_laevigata	RLG00000008067 RLG00000012215
rosa_multiflora	Rmu_sc0002890.1_g000006 Rmu_sc0007265.1_g000001 Rmu_sc0007625.1_g000002 Rmu_sc0020894.1_g000005 Rmu_sc0020894.1_g000006
rosa_roxburghii	Rroxscaffold_5G00359290 Rroxscaffold_7G00177060
rosa_rugosa	Rorug04G0134600 Rorug06G0212700
rosa_samantha	Rh4AG195500 Rh4BG194300 Rh4CG206400 Rh4DG193300 Rh6AG322900 Rh6BG330300 Rh6CG336400 Rh6DG323300
rosa_wichuraiana	Rw4G016650 Rw6G027990

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1149
AatII	GACGTC	1 cut(s)	1153
Acc65I	GGTACC	1 cut(s)	1418
AccB1I	GGYRCC	1 cut(s)	1418
AccI	GTMKAC	1 cut(s)	140
AccII	CGCG	2 cut(s)	567, 1416
AccIII	TCCGGA	2 cut(s)	582, 898
AciI	CCGC	6 cut(s)	567, 914, 1123, 1366, 1416, 1615
AclWI	GGATC	1 cut(s)	432
AcoI	YGGCCR	2 cut(s)	1027, 1441
AcsI	RAATTY	1 cut(s)	577
AcuI	CTGAAG	2 cut(s)	281, 518
AcyI	GRCGYC	1 cut(s)	1150
AfaI	GTAC	5 cut(s)	400, 754, 906, 1021, 1420
AfiI	CCNNNNNNNGG	2 cut(s)	1052, 1535
AflIII	ACRYGT	1 cut(s)	41
AhlI	ACTAGT	1 cut(s)	401
AjnI	CCWGG	2 cut(s)	663, 1647
Alw21I	GWGCWC	1 cut(s)	1197
Alw26I	GTCTC	8 cut(s)	243, 488, 723, 771, 826, 836, 1157, 1405
AlwI	GGATC	1 cut(s)	432
Ama87I	CYCGRG	3 cut(s)	1187, 1227, 1465
Aor13HI	TCCGGA	2 cut(s)	582, 898
ApeKI	GCWGC	7 cut(s)	328, 373, 958, 972, 1374, 1377, 1669
ApoI	RAATTY	1 cut(s)	577
Asp718I	GGTACC	1 cut(s)	1418
AspLEI	GCGC	1 cut(s)	567
AspS9I	GGNCC	6 cut(s)	442, 457, 1100, 1233, 1612, 1655
AvaI	CYCGRG	3 cut(s)	1187, 1227, 1465
AvaII	GGWCC	4 cut(s)	457, 1233, 1612, 1655
BaeI	ACNNNNGTAYC	2 cut(s)	744, 777
BalI	TGGCCA	1 cut(s)	1443
BanI	GGYRCC	1 cut(s)	1418
BanII	GRGCYC	1 cut(s)	1197
BauI	CACGAG	1 cut(s)	1023
BbsI	GAAGAC	1 cut(s)	652
Bbv12I	GWGCWC	1 cut(s)	1197
BbvI	GCAGC	7 cut(s)	340, 385, 970, 984, 1386, 1389, 1681
BccI	CCATC	6 cut(s)	639, 1072, 1283, 1303, 1452, 1628
BceAI	ACGGC	1 cut(s)	1014
BcgI	CGANNNNNNTGC	2 cut(s)	1658, 1692
BciT130I	CCWGG	2 cut(s)	665, 1649
BclI	TGATCA	1 cut(s)	832
BcoDI	GTCTC	8 cut(s)	243, 488, 723, 771, 826, 836, 1157, 1405
BcuI	ACTAGT	1 cut(s)	401
BfaI	CTAG	2 cut(s)	228, 402
BmcAI	AGTACT	1 cut(s)	1021
Bme1390I	CCNGG	2 cut(s)	665, 1649
Bme18I	GGWCC	4 cut(s)	457, 1233, 1612, 1655
BmeT110I	CYCGRG	3 cut(s)	1187, 1227, 1465
BmgT120I	GGNCC	6 cut(s)	442, 457, 1100, 1233, 1612, 1655
BmiI	GGNNCC	5 cut(s)	744, 1234, 1420, 1526, 1656
BmrFI	CCNGG	2 cut(s)	665, 1649
BmrI	ACTGGG	1 cut(s)	812
BmsI	GCATC	4 cut(s)	323, 628, 984, 1626
BmuI	ACTGGG	1 cut(s)	812
BoxI	GACNNNNGTC	1 cut(s)	57
BpiI	GAAGAC	1 cut(s)	652
BplI	GAGNNNNNCTC	4 cut(s)	720, 752, 1513, 1545
BpmI	CTGGAG	3 cut(s)	962, 973, 1670
Bpu10I	CCTNAGC	1 cut(s)	255
BpuEI	CTTGAG	1 cut(s)	1429
BsaAI	YACGTR	1 cut(s)	44
BsaHI	GRCGYC	1 cut(s)	1150
BsaI	GGTCTC	2 cut(s)	243, 488
BsaJI	CCNNGG	3 cut(s)	664, 1051, 1333
BsaWI	WCCGGW	4 cut(s)	582, 898, 1447, 1597
BsaXI	ACNNNNNCTCC	2 cut(s)	806, 836
Bsc4I	CCNNNNNNNGG	2 cut(s)	1052, 1535
Bse118I	RCCGGY	1 cut(s)	1435
Bse1I	ACTGG	3 cut(s)	277, 818, 1540
Bse3DI	GCAATG	1 cut(s)	1458
BseAI	TCCGGA	2 cut(s)	582, 898
BseBI	CCWGG	2 cut(s)	665, 1649
BseDI	CCNNGG	3 cut(s)	664, 1051, 1333
BseGI	GGATG	2 cut(s)	1294, 1444
BseLI	CCNNNNNNNGG	2 cut(s)	1052, 1535
BseMI	GCAATG	1 cut(s)	1458
BseMII	CTCAG	3 cut(s)	246, 751, 1145
BseNI	ACTGG	3 cut(s)	277, 818, 1540
BseRI	GAGGAG	5 cut(s)	73, 405, 800, 1205, 1384
BseXI	GCAGC	7 cut(s)	340, 385, 970, 984, 1386, 1389, 1681
Bsh1236I	CGCG	2 cut(s)	567, 1416
Bsh1285I	CGRYCG	1 cut(s)	137
BshNI	GGYRCC	1 cut(s)	1418
BsiEI	CGRYCG	1 cut(s)	137
BsiHKAI	GWGCWC	1 cut(s)	1197
BsiHKCI	CYCGRG	3 cut(s)	1187, 1227, 1465
BsiSI	CCGG	5 cut(s)	583, 899, 1436, 1448, 1598
BslFI	GGGAC	3 cut(s)	1418, 1583, 1668
BslI	CCNNNNNNNGG	2 cut(s)	1052, 1535
BsmAI	GTCTC	8 cut(s)	243, 488, 723, 771, 826, 836, 1157, 1405
BsmBI	CGTCTC	3 cut(s)	771, 1157, 1405
BsmFI	GGGAC	3 cut(s)	1418, 1583, 1668
BsmI	GAATGC	2 cut(s)	1510, 1586
Bso31I	GGTCTC	2 cut(s)	243, 488
BsoBI	CYCGRG	3 cut(s)	1187, 1227, 1465
Bsp1286I	GDGCHC	1 cut(s)	1197
Bsp13I	TCCGGA	2 cut(s)	582, 898
Bsp143I	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
Bsp19I	CCATGG	1 cut(s)	1051
BspACI	CCGC	6 cut(s)	567, 914, 1123, 1366, 1416, 1615
BspCNI	CTCAG	3 cut(s)	247, 750, 1144
BspEI	TCCGGA	2 cut(s)	582, 898
BspFNI	CGCG	2 cut(s)	567, 1416
BspHI	TCATGA	1 cut(s)	978
BspLI	GGNNCC	5 cut(s)	744, 1234, 1420, 1526, 1656
BspPI	GGATC	1 cut(s)	432
BspT107I	GGYRCC	1 cut(s)	1418
BspTNI	GGTCTC	2 cut(s)	243, 488
BsrDI	GCAATG	1 cut(s)	1458
BsrFI	RCCGGY	1 cut(s)	1435
BsrI	ACTGG	3 cut(s)	277, 818, 1540
BssAI	RCCGGY	1 cut(s)	1435
BssECI	CCNNGG	3 cut(s)	664, 1051, 1333
BssMI	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
BssNI	GRCGYC	1 cut(s)	1150
BssSI	CACGAG	1 cut(s)	1023
BssT1I	CCWWGG	2 cut(s)	1051, 1333
Bst2BI	CACGAG	1 cut(s)	1023
Bst2UI	CCWGG	2 cut(s)	665, 1649
Bst4CI	ACNGT	4 cut(s)	647, 782, 1019, 1423
Bst6I	CTCTTC	5 cut(s)	350, 360, 659, 695, 1118
BstACI	GRCGYC	1 cut(s)	1150
BstBAI	YACGTR	1 cut(s)	44
BstC8I	GCNNGC	6 cut(s)	216, 272, 326, 1315, 1437, 1441
BstDEI	CTNAG	3 cut(s)	255, 737, 1131
BstDSI	CCRYGG	1 cut(s)	1051
BstF5I	GGATG	2 cut(s)	1294, 1444
BstFNI	CGCG	2 cut(s)	567, 1416
BstHHI	GCGC	1 cut(s)	567
BstKTI	GATC	6 cut(s)	137, 427, 484, 514, 559, 835
BstMAI	GTCTC	8 cut(s)	243, 488, 723, 771, 826, 836, 1157, 1405
BstMBI	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
BstMCI	CGRYCG	1 cut(s)	137
BstNI	CCWGG	2 cut(s)	665, 1649
BstPAI	GACNNNNGTC	1 cut(s)	57
BstSCI	CCNGG	2 cut(s)	663, 1647
BstUI	CGCG	2 cut(s)	567, 1416
BstV1I	GCAGC	7 cut(s)	340, 385, 970, 984, 1386, 1389, 1681
BstV2I	GAAGAC	1 cut(s)	652
BstXI	CCANNNNNNTGG	1 cut(s)	685
BtgI	CCRYGG	1 cut(s)	1051
BtgZI	GCGATG	2 cut(s)	346, 351
BtsCI	GGATG	2 cut(s)	1294, 1444
BtsI	GCAGTG	1 cut(s)	272
BtsIMutI	CAGTG	4 cut(s)	272, 284, 543, 1695
Cac8I	GCNNGC	6 cut(s)	216, 272, 326, 1315, 1437, 1441
CciI	TCATGA	1 cut(s)	978
CfoI	GCGC	1 cut(s)	567
Cfr10I	RCCGGY	1 cut(s)	1435
Cfr13I	GGNCC	6 cut(s)	442, 457, 1100, 1233, 1612, 1655
CseI	GACGC	2 cut(s)	1422, 1580
Csp6I	GTAC	5 cut(s)	399, 753, 905, 1020, 1419
CspCI	CAANNNNNGTGG	2 cut(s)	1255, 1290
CviAII	CATG	5 cut(s)	69, 163, 979, 1052, 1237
CviQI	GTAC	5 cut(s)	399, 753, 905, 1020, 1419
DdeI	CTNAG	3 cut(s)	255, 737, 1131
DpnI	GATC	6 cut(s)	136, 426, 483, 513, 558, 834
DpnII	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
DrdI	GACNNNNNNGTC	1 cut(s)	1149
DseDI	GACNNNNNNGTC	1 cut(s)	1149
EaeI	YGGCCR	2 cut(s)	1027, 1441
Eam1104I	CTCTTC	5 cut(s)	350, 360, 659, 695, 1118
EarI	CTCTTC	5 cut(s)	350, 360, 659, 695, 1118
Ecl136II	GAGCTC	1 cut(s)	1195
Eco130I	CCWWGG	2 cut(s)	1051, 1333
Eco147I	AGGCCT	1 cut(s)	986
Eco24I	GRGCYC	1 cut(s)	1197
Eco31I	GGTCTC	2 cut(s)	243, 488
Eco47I	GGWCC	4 cut(s)	457, 1233, 1612, 1655
Eco53kI	GAGCTC	1 cut(s)	1195
Eco57I	CTGAAG	2 cut(s)	281, 518
Eco88I	CYCGRG	3 cut(s)	1187, 1227, 1465
EcoICRI	GAGCTC	1 cut(s)	1195
EcoRII	CCWGG	2 cut(s)	663, 1647
EcoT14I	CCWWGG	2 cut(s)	1051, 1333
EcoT22I	ATGCAT	1 cut(s)	70
EcoT38I	GRGCYC	1 cut(s)	1197
ErhI	CCWWGG	2 cut(s)	1051, 1333
Esp3I	CGTCTC	3 cut(s)	771, 1157, 1405
FaeI	CATG	5 cut(s)	72, 166, 982, 1055, 1240
FalI	AAGNNNNNCTT	2 cut(s)	1262, 1294
FaqI	GGGAC	3 cut(s)	1418, 1583, 1668
FatI	CATG	5 cut(s)	68, 162, 978, 1051, 1236
FbaI	TGATCA	1 cut(s)	832
FblI	GTMKAC	1 cut(s)	140
FokI	GGATG	2 cut(s)	1301, 1431
FriOI	GRGCYC	1 cut(s)	1197
FspBI	CTAG	2 cut(s)	228, 402
GlaI	GCGC	1 cut(s)	566
GsuI	CTGGAG	3 cut(s)	962, 973, 1670
HapII	CCGG	5 cut(s)	583, 899, 1436, 1448, 1598
HgaI	GACGC	2 cut(s)	1422, 1580
HhaI	GCGC	1 cut(s)	567
Hin1I	GRCGYC	1 cut(s)	1150
Hin1II	CATG	5 cut(s)	72, 166, 982, 1055, 1240
Hin6I	GCGC	1 cut(s)	565
HinP1I	GCGC	1 cut(s)	565
HindIII	AAGCTT	2 cut(s)	179, 888
HinfI	GANTC	5 cut(s)	463, 529, 875, 1166, 1555
HpaII	CCGG	5 cut(s)	583, 899, 1436, 1448, 1598
Hpy166II	GTNNAC	4 cut(s)	141, 543, 755, 1612
Hpy188I	TCNGA	5 cut(s)	52, 528, 537, 556, 1533
Hpy8I	GTNNAC	4 cut(s)	141, 543, 755, 1612
HpyAV	CCTTC	7 cut(s)	372, 380, 389, 836, 976, 1028, 1137
HpyCH4III	ACNGT	4 cut(s)	647, 782, 1019, 1423
HpyCH4IV	ACGT	4 cut(s)	43, 724, 1150, 1360
HpyCH4V	TGCA	3 cut(s)	68, 270, 282
HpyF3I	CTNAG	3 cut(s)	255, 737, 1131
HpySE526I	ACGT	4 cut(s)	43, 724, 1150, 1360
Hsp92I	GRCGYC	1 cut(s)	1150
Hsp92II	CATG	5 cut(s)	72, 166, 982, 1055, 1240
HspAI	GCGC	1 cut(s)	565
Kpn2I	TCCGGA	2 cut(s)	582, 898
KpnI	GGTACC	1 cut(s)	1422
KroI	GCCGGC	1 cut(s)	1435
KroNI	GCCGGC	1 cut(s)	1437
Ksp22I	TGATCA	1 cut(s)	832
Kzo9I	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
LmnI	GCTCC	5 cut(s)	628, 1192, 1249, 1346, 1371
Lsp1109I	GCAGC	7 cut(s)	340, 385, 970, 984, 1386, 1389, 1681
LweI	GCATC	4 cut(s)	323, 628, 984, 1626
MaeI	CTAG	2 cut(s)	228, 402
MaeII	ACGT	4 cut(s)	43, 724, 1150, 1360
MaeIII	GTNAC	3 cut(s)	59, 598, 1450
MalI	GATC	6 cut(s)	136, 426, 483, 513, 558, 834
MboI	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
MhlI	GDGCHC	1 cut(s)	1197
MlsI	TGGCCA	1 cut(s)	1443
MluCI	AATT	4 cut(s)	93, 501, 577, 999
MluNI	TGGCCA	1 cut(s)	1443
MlyI	GAGTC	1 cut(s)	1564
Mox20I	TGGCCA	1 cut(s)	1443
Mph1103I	ATGCAT	1 cut(s)	70
MroI	TCCGGA	2 cut(s)	582, 898
MroNI	GCCGGC	1 cut(s)	1435
MscI	TGGCCA	1 cut(s)	1443
MseI	TTAA	1 cut(s)	1623
MslI	CAYNNNNRTG	3 cut(s)	636, 683, 1056
Msp20I	TGGCCA	1 cut(s)	1443
MspA1I	CMGCKG	2 cut(s)	749, 1366
MspI	CCGG	5 cut(s)	583, 899, 1436, 1448, 1598
MspR9I	CCNGG	2 cut(s)	665, 1649
Mva1269I	GAATGC	2 cut(s)	1510, 1586
MvaI	CCWGG	2 cut(s)	665, 1649
MvnI	CGCG	2 cut(s)	567, 1416
NaeI	GCCGGC	1 cut(s)	1437
NcoI	CCATGG	1 cut(s)	1051
NdeII	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
NgoMIV	GCCGGC	1 cut(s)	1435
NlaIII	CATG	5 cut(s)	72, 166, 982, 1055, 1240
NlaIV	GGNNCC	5 cut(s)	744, 1234, 1420, 1526, 1656
NmeAIII	GCCGAG	1 cut(s)	545
NmuCI	GTSAC	3 cut(s)	59, 598, 1450
NsiI	ATGCAT	1 cut(s)	70
PaeR7I	CTCGAG	3 cut(s)	1187, 1227, 1465
PagI	TCATGA	1 cut(s)	978
PceI	AGGCCT	1 cut(s)	986
PcsI	WCGNNNNNNNCGW	1 cut(s)	1194
PctI	GAATGC	2 cut(s)	1510, 1586
PdiI	GCCGGC	1 cut(s)	1437
PfeI	GAWTC	4 cut(s)	463, 529, 875, 1166
PfoI	TCCNGGA	1 cut(s)	1647
Ple19I	CGATCG	1 cut(s)	137
PleI	GAGTC	1 cut(s)	1563
PpsI	GAGTC	1 cut(s)	1563
Ppu21I	YACGTR	1 cut(s)	44
PshAI	GACNNNNGTC	1 cut(s)	57
Psp124BI	GAGCTC	1 cut(s)	1197
Psp6I	CCWGG	2 cut(s)	663, 1647
PspGI	CCWGG	2 cut(s)	663, 1647
PspN4I	GGNNCC	5 cut(s)	744, 1234, 1420, 1526, 1656
PspPI	GGNCC	6 cut(s)	442, 457, 1100, 1233, 1612, 1655
PspXI	VCTCGAGB	3 cut(s)	1187, 1227, 1465
PvuI	CGATCG	1 cut(s)	137
PvuII	CAGCTG	1 cut(s)	749
RsaI	GTAC	5 cut(s)	400, 754, 906, 1021, 1420
RsaNI	GTAC	5 cut(s)	399, 753, 905, 1020, 1419
RseI	CAYNNNNRTG	3 cut(s)	636, 683, 1056
SacI	GAGCTC	1 cut(s)	1197
SaqAI	TTAA	1 cut(s)	1623
Sau3AI	GATC	6 cut(s)	134, 424, 481, 511, 556, 832
Sau96I	GGNCC	6 cut(s)	442, 457, 1100, 1233, 1612, 1655
ScaI	AGTACT	1 cut(s)	1021
SchI	GAGTC	1 cut(s)	1564
ScrFI	CCNGG	2 cut(s)	665, 1649
SduI	GDGCHC	1 cut(s)	1197
SfaNI	GCATC	4 cut(s)	323, 628, 984, 1626
Sfr274I	CTCGAG	3 cut(s)	1187, 1227, 1465
SinI	GGWCC	4 cut(s)	457, 1233, 1612, 1655
SlaI	CTCGAG	3 cut(s)	1187, 1227, 1465
SmiMI	CAYNNNNRTG	3 cut(s)	636, 683, 1056
SmlI	CTYRAG	4 cut(s)	1187, 1227, 1408, 1465
SmoI	CTYRAG	4 cut(s)	1187, 1227, 1408, 1465
SpeI	ACTAGT	1 cut(s)	401
Sse9I	AATT	4 cut(s)	93, 501, 577, 999
SseBI	AGGCCT	1 cut(s)	986
SsiI	CCGC	6 cut(s)	567, 914, 1123, 1366, 1416, 1615
SspMI	CTAG	2 cut(s)	228, 402
SstI	GAGCTC	1 cut(s)	1197
StuI	AGGCCT	1 cut(s)	986
StyD4I	CCNGG	2 cut(s)	663, 1647
StyI	CCWWGG	2 cut(s)	1051, 1333
TaaI	ACNGT	4 cut(s)	647, 782, 1019, 1423
TaiI	ACGT	4 cut(s)	46, 727, 1153, 1363
TaqI	TCGA	8 cut(s)	91, 492, 1091, 1188, 1197, 1228, 1305, 1466
TaqII	GACCGA	1 cut(s)	1672
TasI	AATT	4 cut(s)	93, 501, 577, 999
TatI	WGTACW	1 cut(s)	1019
TauI	GCSGC	3 cut(s)	570, 917, 1126
TfiI	GAWTC	4 cut(s)	463, 529, 875, 1166
Tru1I	TTAA	1 cut(s)	1623
Tru9I	TTAA	1 cut(s)	1623
TscAI	CASTG	4 cut(s)	272, 284, 550, 1695
TseFI	GTSAC	3 cut(s)	59, 598, 1450
TseI	GCWGC	7 cut(s)	328, 373, 958, 972, 1374, 1377, 1669
Tsp45I	GTSAC	3 cut(s)	59, 598, 1450
TspDTI	ATGAA	4 cut(s)	135, 801, 995, 1074
TspGWI	ACGGA	1 cut(s)	1161
TspRI	CASTG	4 cut(s)	272, 284, 550, 1695
VpaK11BI	GGWCC	4 cut(s)	457, 1233, 1612, 1655
XapI	RAATTY	1 cut(s)	577
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1022
XhoI	CTCGAG	3 cut(s)	1187, 1227, 1465
XmiI	GTMKAC	1 cut(s)	140
XspI	CTAG	2 cut(s)	228, 402
ZraI	GACGTC	1 cut(s)	1151
ZrmI	AGTACT	1 cut(s)	1021
Zsp2I	ATGCAT	1 cut(s)	70

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.