Rmu_sc0007265.1_g000001

Seed storage protein. Accumulates during seed development and is hydrolyzed after germination to provide a carbon and nitrogen source for the developing seedling

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007265.1
Physical Location & Seq
Forward (+)
119 .. 1033
915 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007265.1_g000001.1.cds

Sequence Viewer

Length: 696 bp
atggtaatgagggcatcaccacaacaactccaggcattgagtcagcacgcttcttcacccaggagcaaaggccgtcagtctggcaagggtccattcaatcttcgaaaccaaaagcccatccaggccaacgagttcggcaaattattcgaagctcgccctgagaagttcgatcaactccaggacatggatgtctcagtcacttgcgttgaagtcaacaatgaagctatgatgctgccacactacaattctaaagcaatattcgtggtgctggttgtggaaggaagcggacgggtcgagatggcatgcccacacatggcaagccagagccaaatgggtgaggaagaagtagaacaacaaggagaacagatgaaggtcacagctgatgtatcagagggtgatgttttcgttatcccagcaggtcatcccattgccatagttgcccaaaaccaacaattgaaaatgttgggatttggaatcaatgcccaaaacaacaagaggaacttcattgcagggagagaggctaacccgattagggagatggagagagaggctaagcaactgaccttcgggcaagagatggagcagatcatcaacagacagagggaatcttatttcgccccgacagggcagagccagcagcagagaggaggcacagacgagcccttatcttcaattttggcatttgcaggcttttaa

Protein Analysis

231

Amino Acids

25.67

Weight (kDa)

5.67

Isoelectric Point (pI)

55.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 188
Acc36I ACCTGC 1 cut(s) 407
AccB7I CCANNNNNTGG 1 cut(s) 184
AciI CCGC 1 cut(s) 285
AfiI CCNNNNNNNGG 4 cut(s) 184, 313, 532, 624
AgsI TTSAA 4 cut(s) 97, 209, 457, 672
AjnI CCWGG 4 cut(s) 30, 59, 120, 177
AluBI AGCT 3 cut(s) 152, 224, 380
AluI AGCT 3 cut(s) 152, 224, 380
Alw26I GTCTC 1 cut(s) 196
AoxI GGCC 2 cut(s) 70, 123
ApeKI GCWGC 2 cut(s) 232, 637
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 4 cut(s) 9, 48, 347, 407
AsuII TTCGAA 2 cut(s) 103, 147
AvaII GGWCC 1 cut(s) 89
BanII GRGCYC 1 cut(s) 663
BbvI GCAGC 2 cut(s) 219, 649
BccI CCATC 4 cut(s) 125, 292, 532, 571
BceAI ACGGC 1 cut(s) 57
BcgI CGANNNNNNTGC 2 cut(s) 127, 161
BciT130I CCWGG 4 cut(s) 32, 61, 122, 179
BcoDI GTCTC 1 cut(s) 196
BfuAI ACCTGC 1 cut(s) 407
BisI GCNGC 2 cut(s) 233, 638
BlpI GCTNAGC 1 cut(s) 552
BlsI GCNGC 2 cut(s) 234, 639
Bme1390I CCNGG 4 cut(s) 32, 61, 122, 179
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 4 cut(s) 32, 61, 122, 179
BmsI GCATC 2 cut(s) 23, 219
BpmI CTGGAG 2 cut(s) 14, 161
Bpu1102I GCTNAGC 1 cut(s) 552
Bpu14I TTCGAA 2 cut(s) 103, 147
BsaJI CCNNGG 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 12, 42
Bsc4I CCNNNNNNNGG 4 cut(s) 184, 313, 532, 624
Bse3DI GCAATG 2 cut(s) 426, 504
BseBI CCWGG 4 cut(s) 32, 61, 122, 179
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 3 cut(s) 117, 193, 421
BseLI CCNNNNNNNGG 4 cut(s) 184, 313, 532, 624
BseMI GCAATG 2 cut(s) 426, 504
BseMII CTCAG 2 cut(s) 150, 207
BseRI GAGGAG 1 cut(s) 660
BseXI GCAGC 2 cut(s) 219, 649
BseYI CCCAGC 1 cut(s) 412
BshFI GGCC 2 cut(s) 72, 125
BslI CCNNNNNNNGG 4 cut(s) 184, 313, 532, 624
BsmAI GTCTC 1 cut(s) 196
BsnI GGCC 2 cut(s) 72, 125
Bsp119I TTCGAA 2 cut(s) 103, 147
Bsp1286I GDGCHC 1 cut(s) 663
Bsp143I GATC 2 cut(s) 169, 585
Bsp1720I GCTNAGC 1 cut(s) 552
BspACI CCGC 1 cut(s) 285
BspANI GGCC 2 cut(s) 72, 125
BspCNI CTCAG 2 cut(s) 151, 206
BspLI GGNNCC 1 cut(s) 90
BspMI ACCTGC 1 cut(s) 407
BspT104I TTCGAA 2 cut(s) 103, 147
BsrDI GCAATG 2 cut(s) 426, 504
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 2 cut(s) 169, 585
Bst2UI CCWGG 4 cut(s) 32, 61, 122, 179
BstBI TTCGAA 2 cut(s) 103, 147
BstC8I GCNNGC 6 cut(s) 48, 154, 304, 319, 635, 688
BstDEI CTNAG 3 cut(s) 159, 193, 552
BstF5I GGATG 3 cut(s) 117, 193, 421
BstKTI GATC 2 cut(s) 172, 588
BstMAI GTCTC 1 cut(s) 196
BstMBI GATC 2 cut(s) 169, 585
BstMWI GCNNNNNNNGC 2 cut(s) 437, 634
BstNI CCWGG 4 cut(s) 32, 61, 122, 179
BstNSI RCATGY 1 cut(s) 306
BstSCI CCNGG 4 cut(s) 30, 59, 120, 177
BstV1I GCAGC 2 cut(s) 219, 649
BsuRI GGCC 2 cut(s) 72, 125
BtsCI GGATG 3 cut(s) 117, 193, 421
BveI ACCTGC 1 cut(s) 407
Cac8I GCNNGC 6 cut(s) 48, 154, 304, 319, 635, 688
Cfr13I GGNCC 1 cut(s) 89
CspCI CAANNNNNGTGG 2 cut(s) 243, 278
CviAII CATG 3 cut(s) 184, 303, 313
DdeI CTNAG 3 cut(s) 159, 193, 552
DpnI GATC 2 cut(s) 171, 587
DpnII GATC 2 cut(s) 169, 585
DrdI GACNNNNNNGTC 1 cut(s) 188
DseDI GACNNNNNNGTC 1 cut(s) 188
Eco24I GRGCYC 1 cut(s) 663
Eco47I GGWCC 1 cut(s) 89
EcoRII CCWGG 4 cut(s) 30, 59, 120, 177
EcoT38I GRGCYC 1 cut(s) 663
FaeI CATG 3 cut(s) 187, 306, 316
FaiI YATR 5 cut(s) 185, 227, 304, 314, 434
FalI AAGNNNNNCTT 2 cut(s) 485, 517
FatI CATG 3 cut(s) 183, 302, 312
Fnu4HI GCNGC 2 cut(s) 233, 638
FokI GGATG 3 cut(s) 104, 200, 408
FriOI GRGCYC 1 cut(s) 663
Fsp4HI GCNGC 2 cut(s) 233, 638
GluI GCNGC 2 cut(s) 233, 638
GsaI CCCAGC 1 cut(s) 416
GsuI CTGGAG 2 cut(s) 14, 161
HaeIII GGCC 2 cut(s) 72, 125
Hin1II CATG 3 cut(s) 187, 306, 316
HincII GTYRAC 1 cut(s) 214
HindII GTYRAC 1 cut(s) 214
HinfI GANTC 3 cut(s) 40, 474, 605
HphI GGTGA 4 cut(s) 9, 48, 347, 407
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 391
Hpy188III TCNNGA 1 cut(s) 295
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 3 cut(s) 272, 364, 574
HpyCH4V TGCA 2 cut(s) 509, 686
HpyF10VI GCNNNNNNNGC 2 cut(s) 437, 634
HpyF3I CTNAG 3 cut(s) 159, 193, 552
Hsp92II CATG 3 cut(s) 187, 306, 316
Kzo9I GATC 2 cut(s) 169, 585
LmnI GCTCC 2 cut(s) 63, 580
Lsp1109I GCAGC 2 cut(s) 219, 649
LweI GCATC 2 cut(s) 23, 219
MaeIII GTNAC 2 cut(s) 196, 373
MalI GATC 2 cut(s) 171, 587
MboI GATC 2 cut(s) 169, 585
MboII GAAGA 4 cut(s) 45, 92, 353, 660
MfeI CAATTG 1 cut(s) 452
MhlI GDGCHC 1 cut(s) 663
MluCI AATT 4 cut(s) 140, 244, 452, 672
MlyI GAGTC 1 cut(s) 49
MnlI CCTC 9 cut(s) 3, 331, 385, 489, 511, 541, 594, 638, 641
MseI TTAA 1 cut(s) 694
MspA1I CMGCKG 1 cut(s) 380
MspR9I CCNGG 4 cut(s) 32, 61, 122, 179
MunI CAATTG 1 cut(s) 452
MvaI CCWGG 4 cut(s) 32, 61, 122, 179
MwoI GCNNNNNNNGC 2 cut(s) 437, 634
NdeII GATC 2 cut(s) 169, 585
NlaIII CATG 3 cut(s) 187, 306, 316
NlaIV GGNNCC 1 cut(s) 90
NmuCI GTSAC 2 cut(s) 196, 373
NspI RCATGY 1 cut(s) 306
NspV TTCGAA 2 cut(s) 103, 147
PaeI GCATGC 1 cut(s) 306
PfeI GAWTC 2 cut(s) 474, 605
PflMI CCANNNNNTGG 1 cut(s) 184
PfoI TCCNGGA 1 cut(s) 177
PkrI GCNGC 2 cut(s) 234, 639
PleI GAGTC 1 cut(s) 48
PpsI GAGTC 1 cut(s) 48
Psp6I CCWGG 4 cut(s) 30, 59, 120, 177
PspFI CCCAGC 1 cut(s) 412
PspGI CCWGG 4 cut(s) 30, 59, 120, 177
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 89
PvuII CAGCTG 1 cut(s) 380
SaqAI TTAA 1 cut(s) 694
SatI GCNGC 2 cut(s) 233, 638
Sau3AI GATC 2 cut(s) 169, 585
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 1 cut(s) 49
ScrFI CCNGG 4 cut(s) 32, 61, 122, 179
SduI GDGCHC 1 cut(s) 663
SetI ASST 6 cut(s) 154, 226, 375, 382, 421, 566
SfaNI GCATC 2 cut(s) 23, 219
SfuI TTCGAA 2 cut(s) 103, 147
SinI GGWCC 1 cut(s) 89
SphI GCATGC 1 cut(s) 306
Sse9I AATT 4 cut(s) 140, 244, 452, 672
SsiI CCGC 1 cut(s) 285
SspI AATATT 1 cut(s) 258
StyD4I CCNGG 4 cut(s) 30, 59, 120, 177
TaqI TCGA 4 cut(s) 103, 147, 168, 294
TasI AATT 4 cut(s) 140, 244, 452, 672
TfiI GAWTC 2 cut(s) 474, 605
Tru1I TTAA 1 cut(s) 694
Tru9I TTAA 1 cut(s) 694
TseFI GTSAC 2 cut(s) 196, 373
TseI GCWGC 2 cut(s) 232, 637
Tsp45I GTSAC 2 cut(s) 196, 373
TspDTI ATGAA 3 cut(s) 234, 383, 493
Van91I CCANNNNNTGG 1 cut(s) 184
VpaK11BI GGWCC 1 cut(s) 89
XceI RCATGY 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.