MD11G1169000.v1.1

Protein phosphatase 1 regulatory subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
18124055 .. 18124574
520 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1169000.v1.1.491

Sequence Viewer

Length: 441 bp
ATGGGTGAAACCAATGGTGATATTGAAAATGCTAGTCATTCTGATACAAAGAAATCGAAATGGAAAAGGCAGGGATCAAAAGACAACACCTCAAACAATGTTGTTGTTGTCGAGGGGGATGAAAAAAGAGATCCCGTCAAGAAAAAGAACCGCAAACATCAAGTGCAAAATGAAGATGATCGTGGTAATCTTGAGAATACTGGGGATTTTGAGAAAGCATCGCAACAGAAGAAGCAGAAAAAGAGTTCAGCCCATACAGAAGACAATACCAGGGTTGGAAAGAAATCAGAGAAATCCAAGGTGAGAAAAGGTGACCTTGATGTTATCGATGATGCAGATACACCATTTTTGAAGCTTTTTTCTGTTGATGCTAAGGTTGCTGGTGAAAAAAAGGCTAAGGACAAGGTAATATTATTGGGTGGCTTAGTAACCTTCCCTTGA

Protein Analysis

147

Amino Acids

16.25

Weight (kDa)

9.38

Isoelectric Point (pI)

17.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 151
AclWI GGATC 2 cut(s) 82, 125
AgsI TTSAA 2 cut(s) 26, 352
AjnI CCWGG 1 cut(s) 269
AluBI AGCT 1 cut(s) 355
AluI AGCT 1 cut(s) 355
AlwI GGATC 2 cut(s) 82, 125
AsuHPI GGTGA 5 cut(s) 17, 29, 313, 323, 395
BbsI GAAGAC 1 cut(s) 267
BciT130I CCWGG 1 cut(s) 271
BfaI CTAG 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 271
BmrFI CCNGG 1 cut(s) 271
BmrI ACTGGG 1 cut(s) 210
BmsI GCATC 3 cut(s) 227, 322, 358
BmuI ACTGGG 1 cut(s) 210
BpiI GAAGAC 1 cut(s) 267
Bpu10I CCTNAGC 2 cut(s) 372, 396
BpuEI CTTGAG 1 cut(s) 212
Bsa29I ATCGAT 1 cut(s) 327
BsaJI CCNNGG 2 cut(s) 270, 297
Bse1I ACTGG 1 cut(s) 205
BseBI CCWGG 1 cut(s) 271
BseCI ATCGAT 1 cut(s) 327
BseDI CCNNGG 2 cut(s) 270, 297
BseGI GGATG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 205
BshVI ATCGAT 1 cut(s) 327
Bsp143I GATC 3 cut(s) 74, 130, 178
BspACI CCGC 1 cut(s) 151
BspDI ATCGAT 1 cut(s) 327
BspPI GGATC 2 cut(s) 82, 125
BsrI ACTGG 1 cut(s) 205
BssECI CCNNGG 2 cut(s) 270, 297
BssMI GATC 3 cut(s) 74, 130, 178
BssT1I CCWWGG 1 cut(s) 297
Bst2UI CCWGG 1 cut(s) 271
BstDEI CTNAG 3 cut(s) 372, 396, 424
BstEII GGTNACC 1 cut(s) 311
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 3 cut(s) 77, 133, 181
BstMBI GATC 3 cut(s) 74, 130, 178
BstMWI GCNNNNNNNGC 1 cut(s) 377
BstNI CCWGG 1 cut(s) 271
BstPI GGTNACC 1 cut(s) 311
BstSCI CCNGG 1 cut(s) 269
BstV2I GAAGAC 1 cut(s) 267
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
Bsu15I ATCGAT 1 cut(s) 327
BsuTUI ATCGAT 1 cut(s) 327
BtgZI GCGATG 1 cut(s) 204
BtsCI GGATG 1 cut(s) 124
ClaI ATCGAT 1 cut(s) 327
CviJI RGCY 4 cut(s) 251, 355, 395, 423
CviKI_1 RGCY 4 cut(s) 251, 355, 395, 423
DdeI CTNAG 3 cut(s) 372, 396, 424
DpnI GATC 3 cut(s) 76, 132, 180
DpnII GATC 3 cut(s) 74, 130, 178
Eco130I CCWWGG 1 cut(s) 297
Eco91I GGTNACC 1 cut(s) 311
EcoO65I GGTNACC 1 cut(s) 311
EcoRII CCWGG 1 cut(s) 269
EcoT14I CCWWGG 1 cut(s) 297
ErhI CCWWGG 1 cut(s) 297
FaiI YATR 1 cut(s) 255
FalI AAGNNNNNCTT 2 cut(s) 300, 332
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 33
HindIII AAGCTT 1 cut(s) 353
HphI GGTGA 5 cut(s) 17, 29, 313, 323, 395
Hpy188I TCNGA 2 cut(s) 43, 289
Hpy188III TCNNGA 2 cut(s) 139, 191
HpyCH4V TGCA 2 cut(s) 166, 335
HpyF10VI GCNNNNNNNGC 1 cut(s) 377
HpyF3I CTNAG 3 cut(s) 372, 396, 424
Kzo9I GATC 3 cut(s) 74, 130, 178
LpnPI CCDG 5 cut(s) 56, 186, 256, 283, 366
LweI GCATC 3 cut(s) 227, 322, 358
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 311, 427
MalI GATC 3 cut(s) 76, 132, 180
MboI GATC 3 cut(s) 74, 130, 178
MboII GAAGA 3 cut(s) 185, 241, 272
MflI RGATCY 1 cut(s) 130
MmeI TCCRAC 1 cut(s) 256
MnlI CCTC 2 cut(s) 100, 106
MspR9I CCNGG 1 cut(s) 271
MvaI CCWGG 1 cut(s) 271
MwoI GCNNNNNNNGC 1 cut(s) 377
NdeII GATC 3 cut(s) 74, 130, 178
NmuCI GTSAC 1 cut(s) 311
Psp6I CCWGG 1 cut(s) 269
PspEI GGTNACC 1 cut(s) 311
PspGI CCWGG 1 cut(s) 269
PsuI RGATCY 1 cut(s) 130
Sau3AI GATC 3 cut(s) 74, 130, 178
ScrFI CCNGG 1 cut(s) 271
SetI ASST 8 cut(s) 92, 303, 313, 318, 357, 378, 408, 434
SfaNI GCATC 3 cut(s) 227, 322, 358
SmlI CTYRAG 1 cut(s) 191
SmoI CTYRAG 1 cut(s) 191
SsiI CCGC 1 cut(s) 151
SspI AATATT 1 cut(s) 411
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 269
StyI CCWWGG 1 cut(s) 297
TaqI TCGA 3 cut(s) 56, 111, 327
TseFI GTSAC 1 cut(s) 311
Tsp45I GTSAC 1 cut(s) 311
TspDTI ATGAA 2 cut(s) 135, 186
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.