RchiOBHm_Chr5g0023971

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
18178577 .. 18181108
2532 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30376

Sequence Viewer

Length: 159 bp
ATGGCCATTCTGGCAGAAACCAGAAAGAAAGAAAGAGAAAGAGAGAGGAGAAAGAAAGAAAGAGAGAAAGAGAAAGAAAGAAGGAAAGAAAGAAAGGGAGATCCGTCCAAACCGTCGACATTTTGGAGAAACCTCAAGGTACTTGACGGTTTGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.41

Weight (kDa)

10.52

Isoelectric Point (pI)

43.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 116
AclWI GGATC 1 cut(s) 95
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 141
AlwI GGATC 1 cut(s) 95
AoxI GGCC 1 cut(s) 3
BalI TGGCCA 1 cut(s) 5
BglI GCCNNNNNGGC 1 cut(s) 11
BpuEI CTTGAG 1 cut(s) 119
BseRI GAGGAG 1 cut(s) 61
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 100
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 95
BssMI GATC 1 cut(s) 100
Bst4CI ACNGT 2 cut(s) 114, 149
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 5
Csp6I GTAC 1 cut(s) 140
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 1 cut(s) 140
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
EaeI YGGCCR 1 cut(s) 3
FblI GTMKAC 1 cut(s) 116
HaeIII GGCC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 117
HindII GTYRAC 1 cut(s) 117
Hpy166II GTNNAC 1 cut(s) 117
Hpy8I GTNNAC 1 cut(s) 117
Hpy99I CGWCG 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 75
HpyCH4III ACNGT 2 cut(s) 114, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 1 cut(s) 34
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MflI RGATCY 1 cut(s) 100
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 39, 143
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 100
PsuI RGATCY 1 cut(s) 100
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
SalI GTCGAC 1 cut(s) 115
Sau3AI GATC 1 cut(s) 100
SetI ASST 2 cut(s) 135, 141
SgeI CNNG 4 cut(s) 23, 33, 148, 155
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
TaaI ACNGT 2 cut(s) 114, 149
TaqI TCGA 1 cut(s) 116
TspGWI ACGGA 1 cut(s) 93
XmiI GTMKAC 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.