pycom11g14210

Protein phosphatase 1 regulatory subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
14013499 .. 14014009
511 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g14210.1

Sequence Viewer

Length: 459 bp
ATGGGTGAAACCAATGTTGATATCGAAAATGCTAGTCATTCTGATACAAAGAAATCGAAATGGAAAAGGCAGGGATCAAAAGACAATGCCTCAAACAATGTTGTTGTCGAGGGGGATGAAAAACGAGATCCTGTCAAGAAAAAGAACCGCAAACATCAAATCATCGCAACAGAAGACAATACCAAGGTTGGAAAGAAATCAGAGAAATTCCAGATGAGAAAAGGTGACCTTGATGTTATCGATGATACAGATACACCATTTTTGGAGCTTTTTTCTGTTGATGCTGAGGTTGCTGGTGAAGAAAAGGCTAAGGACAAGGTAATAGAATTGGGTGGCTTAGTAACCTTCCCTTGTAAGAGTAAAAAAGCAAAAAACTTGGCCTCCACCGATTCTACTCTACAGCCGTCGCATGTTGATGAAATTGGAACAGGCGGGCCATCAACATGGGGTGATGATTAG

Protein Analysis

153

Amino Acids

16.69

Weight (kDa)

5.7

Isoelectric Point (pI)

25.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 148, 432
AclWI GGATC 2 cut(s) 82, 122
AcsI RAATTY 1 cut(s) 206
AluBI AGCT 1 cut(s) 268
AluI AGCT 1 cut(s) 268
AlwI GGATC 2 cut(s) 82, 122
AoxI GGCC 2 cut(s) 378, 434
ApoI RAATTY 1 cut(s) 206
AspS9I GGNCC 1 cut(s) 434
AsuHPI GGTGA 3 cut(s) 17, 236, 308
BbsI GAAGAC 1 cut(s) 180
BbvCI CCTCAGC 1 cut(s) 285
BccI CCATC 1 cut(s) 445
BceAI ACGGC 1 cut(s) 388
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 398
BmgT120I GGNCC 1 cut(s) 434
BmsI GCATC 1 cut(s) 271
BpiI GAAGAC 1 cut(s) 180
Bpu10I CCTNAGC 2 cut(s) 285, 309
Bsa29I ATCGAT 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 183
BsaXI ACNNNNNCTCC 2 cut(s) 365, 395
BseCI ATCGAT 1 cut(s) 240
BseDI CCNNGG 1 cut(s) 183
BseGI GGATG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 276
BshFI GGCC 2 cut(s) 380, 436
BshVI ATCGAT 1 cut(s) 240
BsnI GGCC 2 cut(s) 380, 436
Bsp143I GATC 2 cut(s) 74, 127
BspACI CCGC 2 cut(s) 148, 432
BspANI GGCC 2 cut(s) 380, 436
BspCNI CTCAG 1 cut(s) 277
BspDI ATCGAT 1 cut(s) 240
BspPI GGATC 2 cut(s) 82, 122
BssECI CCNNGG 1 cut(s) 183
BssMI GATC 2 cut(s) 74, 127
BssT1I CCWWGG 1 cut(s) 183
BstC8I GCNNGC 1 cut(s) 434
BstDEI CTNAG 3 cut(s) 285, 309, 337
BstEII GGTNACC 1 cut(s) 224
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 2 cut(s) 77, 130
BstMBI GATC 2 cut(s) 74, 127
BstMWI GCNNNNNNNGC 1 cut(s) 290
BstNSI RCATGY 1 cut(s) 413
BstPI GGTNACC 1 cut(s) 224
BstSFI CTRYAG 1 cut(s) 398
BstV2I GAAGAC 1 cut(s) 180
BstX2I RGATCY 1 cut(s) 127
BstXI CCANNNNNNTGG 1 cut(s) 444
BstYI RGATCY 1 cut(s) 127
Bsu15I ATCGAT 1 cut(s) 240
BsuRI GGCC 2 cut(s) 380, 436
BsuTUI ATCGAT 1 cut(s) 240
BtgZI GCGATG 1 cut(s) 148
BtsCI GGATG 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 434
Cfr13I GGNCC 1 cut(s) 434
ClaI ATCGAT 1 cut(s) 240
CviAII CATG 2 cut(s) 410, 444
CviJI RGCY 6 cut(s) 268, 308, 336, 380, 403, 436
CviKI_1 RGCY 6 cut(s) 268, 308, 336, 380, 403, 436
DdeI CTNAG 3 cut(s) 285, 309, 337
DpnI GATC 2 cut(s) 76, 129
DpnII GATC 2 cut(s) 74, 127
Eco130I CCWWGG 1 cut(s) 183
Eco32I GATATC 1 cut(s) 22
Eco91I GGTNACC 1 cut(s) 224
EcoO65I GGTNACC 1 cut(s) 224
EcoRV GATATC 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 2 cut(s) 413, 447
FaiI YATR 2 cut(s) 411, 445
FalI AAGNNNNNCTT 2 cut(s) 213, 245
FatI CATG 2 cut(s) 409, 443
FauI CCCGC 1 cut(s) 425
FokI GGATG 1 cut(s) 128
FspBI CTAG 1 cut(s) 33
HaeIII GGCC 2 cut(s) 380, 436
Hin1II CATG 2 cut(s) 413, 447
HinfI GANTC 1 cut(s) 389
HphI GGTGA 3 cut(s) 17, 236, 308
Hpy188I TCNGA 2 cut(s) 43, 202
Hpy188III TCNNGA 2 cut(s) 136, 211
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 1 cut(s) 355
HpyF10VI GCNNNNNNNGC 1 cut(s) 290
HpyF3I CTNAG 3 cut(s) 285, 309, 337
Hsp92II CATG 2 cut(s) 413, 447
Kzo9I GATC 2 cut(s) 74, 127
LmnI GCTCC 1 cut(s) 265
LpnPI CCDG 5 cut(s) 56, 144, 224, 279, 414
LweI GCATC 1 cut(s) 271
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 224, 340
MalI GATC 2 cut(s) 76, 129
MboI GATC 2 cut(s) 74, 127
MboII GAAGA 2 cut(s) 185, 311
MflI RGATCY 1 cut(s) 127
MluCI AATT 3 cut(s) 206, 326, 420
MmeI TCCRAC 1 cut(s) 169
MnlI CCTC 4 cut(s) 100, 103, 280, 391
MslI CAYNNNNRTG 2 cut(s) 414, 442
MwoI GCNNNNNNNGC 1 cut(s) 290
NdeII GATC 2 cut(s) 74, 127
NlaIII CATG 2 cut(s) 413, 447
NmuCI GTSAC 1 cut(s) 224
NspI RCATGY 1 cut(s) 413
PfeI GAWTC 1 cut(s) 389
PspEI GGTNACC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 434
PsuI RGATCY 1 cut(s) 127
RseI CAYNNNNRTG 2 cut(s) 414, 442
Sau3AI GATC 2 cut(s) 74, 127
Sau96I GGNCC 1 cut(s) 434
SetI ASST 7 cut(s) 189, 226, 231, 270, 291, 321, 347
SfaNI GCATC 1 cut(s) 271
SfcI CTRYAG 1 cut(s) 398
SmiMI CAYNNNNRTG 2 cut(s) 414, 442
Sse9I AATT 3 cut(s) 206, 326, 420
SsiI CCGC 2 cut(s) 148, 432
SspMI CTAG 1 cut(s) 33
StyI CCWWGG 1 cut(s) 183
TaqI TCGA 4 cut(s) 24, 56, 108, 240
TasI AATT 3 cut(s) 206, 326, 420
TfiI GAWTC 1 cut(s) 389
TseFI GTSAC 1 cut(s) 224
Tsp45I GTSAC 1 cut(s) 224
TspDTI ATGAA 2 cut(s) 132, 432
XapI RAATTY 1 cut(s) 206
XceI RCATGY 1 cut(s) 413
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.