Rroxscaffold_4G00313920
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
37638023 .. 37641177
3155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00313920.1

Sequence Viewer

Length: 201 bp
ATGTCTGATTATGATAATGAAATTGATCTAATGAAGACTCTTAACATTAGAAGAATACTTGGCCTCTCTAAGAAGAAGAAGCAGTGGCTTTTCAAGTGGTGTATCCAAGGACAAAGGAGTTGCAAGGACAATGGCAATTACAACCCCTTCATCAAATGTGACTGTTCTGATAATGTCACTTGCCACATTACCCAGCTGTAA

Protein Analysis

66

Amino Acids

7.81

Weight (kDa)

8.91

Isoelectric Point (pI)

65.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 196
AluI AGCT 1 cut(s) 196
AoxI GGCC 1 cut(s) 61
BbsI GAAGAC 1 cut(s) 41
BciVI GTATCC 1 cut(s) 113
BfuI GTATCC 1 cut(s) 113
BpiI GAAGAC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 106
BseYI CCCAGC 1 cut(s) 192
BshFI GGCC 1 cut(s) 63
BsnI GGCC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 25
BspANI GGCC 1 cut(s) 63
BssECI CCNNGG 1 cut(s) 106
BssMI GATC 1 cut(s) 25
BssT1I CCWWGG 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BstV2I GAAGAC 1 cut(s) 41
BsuI GTATCC 1 cut(s) 113
BsuRI GGCC 1 cut(s) 63
BtsI GCAGTG 1 cut(s) 89
BtsIMutI CAGTG 1 cut(s) 89
CviJI RGCY 3 cut(s) 63, 88, 196
CviKI_1 RGCY 3 cut(s) 63, 88, 196
DdeI CTNAG 1 cut(s) 69
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
Eco130I CCWWGG 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 106
FaiI YATR 1 cut(s) 12
GsaI CCCAGC 1 cut(s) 196
HaeIII GGCC 1 cut(s) 63
HinfI GANTC 1 cut(s) 37
Hpy188I TCNGA 2 cut(s) 7, 169
HpyAV CCTTC 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 1 cut(s) 123
HpyF3I CTNAG 1 cut(s) 69
Kzo9I GATC 1 cut(s) 25
MaeIII GTNAC 2 cut(s) 158, 175
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 4 cut(s) 46, 63, 85, 88
MluCI AATT 2 cut(s) 21, 136
MlyI GAGTC 1 cut(s) 31
MnlI CCTC 1 cut(s) 74
MseI TTAA 1 cut(s) 42
MspA1I CMGCKG 1 cut(s) 196
NdeII GATC 1 cut(s) 25
NmuCI GTSAC 2 cut(s) 158, 175
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
PspFI CCCAGC 1 cut(s) 192
PvuII CAGCTG 1 cut(s) 196
SaqAI TTAA 1 cut(s) 42
Sau3AI GATC 1 cut(s) 25
SchI GAGTC 1 cut(s) 31
SetI ASST 1 cut(s) 198
SgeI CNNG 5 cut(s) 71, 106, 119, 136, 192
Sse9I AATT 2 cut(s) 21, 136
StyI CCWWGG 1 cut(s) 106
TaaI ACNGT 1 cut(s) 164
TasI AATT 2 cut(s) 21, 136
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 89
TseFI GTSAC 2 cut(s) 158, 175
Tsp45I GTSAC 2 cut(s) 158, 175
TspDTI ATGAA 3 cut(s) 33, 47, 139
TspRI CASTG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.