Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000006

Orthogroup ID

OG0004769

Physical Location & Seq

Genomic Coordinates Reverse (-)

13994458 .. 14000657

Gene Structure 6200 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_6G00393790.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGAAAGAAAGAAAGGGAAATCCGTCCAAACCGTCGACATTTTGGAGAAACCTCAAGGTGCTTGATTCATTGGTCAATCTGAAGAATCTCAATTTGCAAGGAAACCCTATTGCTGAAAAGTATAAGGCTAAGAAGGATAATAGCGATGACAACCCCTTCATCAAATGTGACTGTTCTGATAATGTCACTTGCCACATTGCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0000226 GO:0001578 GO:0001669 GO:0002177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005856 GO:0006996 GO:0007010 GO:0007017 GO:0007276 GO:0007283 GO:0008150 GO:0009987 GO:0012505 GO:0015630 GO:0016043 GO:0019953 GO:0022414 GO:0022607 GO:0030030 GO:0030031 GO:0030141 GO:0031410 GO:0031982 GO:0032501 GO:0032504 GO:0035082 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043232 GO:0044085 GO:0044422 GO:0044424 GO:0044430 GO:0044444 GO:0044446 GO:0044464 GO:0044703 GO:0044782 GO:0048232 GO:0048609 GO:0051704 GO:0060271 GO:0070925 GO:0071840 GO:0097223 GO:0097708 GO:0099503 GO:0120031 GO:0120036

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

LRR_4 LRR_6 LRR_8

Protein Analysis

67

Amino Acids

7.61

Weight (kDa)

9.12

Isoelectric Point (pI)

31.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004769)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G22320 AT5G22320
fragaria_vesca	FvH4_3g25730 FvH4_3g25730 FvH4_3g25730 FvH4_3g25730
malus_domestica	MD03G1150100.v1.1 MD11G1168900.v1.1 MD11G1169000.v1.1
prunus_persica	Prupe.6G137100_v2.0.a1 Prupe.6G137100_v2.0.a1 Prupe.6G137100_v2.0.a1 Prupe.6G137100_v2.0.a1
pyrus_communis	pycom03g10420 pycom11g14210
rosa_chinensis	RchiOBHm_Chr5g0023971 RchiOBHm_Chr5g0046091
rosa_laevigata	RLG00000034140 RLG00000034385
rosa_multiflora	Rmu_co8377827.1_g000001 Rmu_sc0001035.1_g000048 Rmu_sc0001035.1_g000052
rosa_roxburghii	Rroxscaffold_1G00035350 Rroxscaffold_4G00313920 Rroxscaffold_6G00393790
rosa_rugosa	Rorug05G0225900 Rorug05G0226000
rosa_samantha	Rh5BG315000 Rh5CG341300 Rh5DG325200
rosa_wichuraiana	Rw5G028670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	35
AcuI	CTGAAG	1 cut(s)	101
BpuEI	CTTGAG	1 cut(s)	38
Bse3DI	GCAATG	1 cut(s)	195
BseMI	GCAATG	1 cut(s)	195
BsrDI	GCAATG	1 cut(s)	195
Bst4CI	ACNGT	2 cut(s)	33, 173
BstDEI	CTNAG	1 cut(s)	129
BtgZI	GCGATG	1 cut(s)	159
CviJI	RGCY	1 cut(s)	128
CviKI_1	RGCY	1 cut(s)	128
DdeI	CTNAG	1 cut(s)	129
Eco57I	CTGAAG	1 cut(s)	101
FaiI	YATR	2 cut(s)	123, 202
FblI	GTMKAC	1 cut(s)	35
HincII	GTYRAC	1 cut(s)	36
HindII	GTYRAC	1 cut(s)	36
HinfI	GANTC	2 cut(s)	65, 85
Hpy166II	GTNNAC	1 cut(s)	36
Hpy188I	TCNGA	2 cut(s)	81, 178
Hpy8I	GTNNAC	1 cut(s)	36
Hpy99I	CGWCG	1 cut(s)	37
HpyAV	CCTTC	2 cut(s)	127, 166
HpyCH4III	ACNGT	2 cut(s)	33, 173
HpyCH4V	TGCA	2 cut(s)	97, 200
HpyF3I	CTNAG	1 cut(s)	129
MaeIII	GTNAC	2 cut(s)	167, 184
MboII	GAAGA	1 cut(s)	94
MluCI	AATT	1 cut(s)	91
MnlI	CCTC	1 cut(s)	62
NmuCI	GTSAC	2 cut(s)	167, 184
PfeI	GAWTC	2 cut(s)	65, 85
SalI	GTCGAC	1 cut(s)	34
SetI	ASST	2 cut(s)	54, 60
SgeI	CNNG	3 cut(s)	67, 74, 110
SmlI	CTYRAG	1 cut(s)	53
SmoI	CTYRAG	1 cut(s)	53
Sse9I	AATT	1 cut(s)	91
TaaI	ACNGT	2 cut(s)	33, 173
TaqI	TCGA	1 cut(s)	35
TasI	AATT	1 cut(s)	91
TfiI	GAWTC	2 cut(s)	65, 85
TseFI	GTSAC	2 cut(s)	167, 184
Tsp45I	GTSAC	2 cut(s)	167, 184
TspDTI	ATGAA	3 cut(s)	17, 57, 148
TspGWI	ACGGA	1 cut(s)	12
XmiI	GTMKAC	1 cut(s)	35

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.