MD11G1194200.v1.1

f-box protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
27848732 .. 27850669
1938 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1194200.v1.1.491

Sequence Viewer

Length: 174 bp
ATGAACGAAGAGGACCCTGAAGCAATGTCGTTACAGGCAGTGAAAGGGAACCCATATACCAGCCCTTTACTGTTGTCGAAGAGGTCGATGGCTTCCCCTAAATCAGAATTCGCCCACAAAACCCTACTCCCCTATTGGGCAAATATTGATCTTTATGCAGTTGGCTCCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.3

Weight (kDa)

5.6

Isoelectric Point (pI)

83.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 107
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 136
ApoI RAATTY 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 13
AvaII GGWCC 1 cut(s) 13
BccI CCATC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 13
BmgT120I GGNCC 1 cut(s) 13
BmiI GGNNCC 3 cut(s) 15, 50, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse3DI GCAATG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 136
Bsp143I GATC 1 cut(s) 148
BspLI GGNNCC 3 cut(s) 15, 50, 166
BsrDI GCAATG 1 cut(s) 30
BssMI GATC 1 cut(s) 148
Bst4CI ACNGT 1 cut(s) 72
Bst6I CTCTTC 2 cut(s) 3, 74
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 45
Cfr13I GGNCC 1 cut(s) 13
CviJI RGCY 3 cut(s) 63, 92, 165
CviKI_1 RGCY 3 cut(s) 63, 92, 165
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eam1104I CTCTTC 2 cut(s) 3, 74
EarI CTCTTC 2 cut(s) 3, 74
Eco47I GGWCC 1 cut(s) 13
Eco57I CTGAAG 1 cut(s) 39
EcoO109I RGGNCCY 1 cut(s) 13
EcoRI GAATTC 1 cut(s) 107
FaiI YATR 3 cut(s) 55, 57, 156
Hpy188I TCNGA 1 cut(s) 106
HpyCH4III ACNGT 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 158
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 3 cut(s) 20, 30, 73
MaeIII GTNAC 1 cut(s) 30
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 2 cut(s) 20, 91
MluCI AATT 1 cut(s) 107
MnlI CCTC 2 cut(s) 4, 75
MseI TTAA 1 cut(s) 172
NdeII GATC 1 cut(s) 148
NlaIV GGNNCC 3 cut(s) 15, 50, 166
PcsI WCGNNNNNNNCGW 1 cut(s) 83
PpuMI RGGWCCY 1 cut(s) 13
Psp5II RGGWCCY 1 cut(s) 13
PspN4I GGNNCC 3 cut(s) 15, 50, 166
PspPI GGNCC 1 cut(s) 13
PspPPI RGGWCCY 1 cut(s) 13
SaqAI TTAA 1 cut(s) 172
Sau3AI GATC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 13
SetI ASST 1 cut(s) 86
SgeI CNNG 3 cut(s) 29, 47, 72
SinI GGWCC 1 cut(s) 13
Sse9I AATT 1 cut(s) 107
SspI AATATT 1 cut(s) 145
TaaI ACNGT 1 cut(s) 72
TaqI TCGA 2 cut(s) 77, 86
TasI AATT 1 cut(s) 107
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
TscAI CASTG 1 cut(s) 45
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 13
XapI RAATTY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.