Rmu_sc0001813.1_g000001

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001813.1
OG0001980
Physical Location & Seq
Forward (+)
1 .. 311
311 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001813.1_g000001.1.cds

Sequence Viewer

Length: 311 bp
tcccgaatctggctgaggtagacattgttcatgcttgcattaggccgtcgaggagttcgaggattattgtgacaaggaggggtttgtcggtgcatgtggactcgctgttcacttcaggtgggtttattgaagaaatagatgtgttgaagcagagtgtggtggatgatgggctgagattgattgcaaacctgaatctgcggcggattgcggtgatagatgtcgggattgatggactgttgagcgttgcaaaggagtgtcagacactgcaggagttggaactgcattgctgtggggaccagggccggtcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like Remorin_C

Protein Analysis

102

Amino Acids

11.13

Weight (kDa)

5.51

Isoelectric Point (pI)

64.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 20
AciI CCGC 3 cut(s) 198, 201, 208
AcuI CTGAAG 1 cut(s) 98
AfiI CCNNNNNNNGG 1 cut(s) 9
AgsI TTSAA 2 cut(s) 130, 147
AjnI CCWGG 1 cut(s) 296
AloI GAACNNNNNNTCC 2 cut(s) 91, 123
AlwNI CAGNNNCTG 1 cut(s) 264
AoxI GGCC 2 cut(s) 43, 300
AspS9I GGNCC 3 cut(s) 294, 300, 305
AsuHPI GGTGA 1 cut(s) 222
AvaII GGWCC 2 cut(s) 294, 305
BbvCI CCTCAGC 1 cut(s) 14
BccI CCATC 2 cut(s) 160, 223
BceAI ACGGC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 298
BfmI CTRYAG 1 cut(s) 265
BisI GCNGC 1 cut(s) 199
BlsI GCNGC 1 cut(s) 200
Bme1390I CCNGG 1 cut(s) 298
Bme18I GGWCC 2 cut(s) 294, 305
BmgT120I GGNCC 3 cut(s) 294, 300, 305
BmiI GGNNCC 1 cut(s) 295
BmrFI CCNGG 1 cut(s) 298
Bpu10I CCTNAGC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 297
Bsc4I CCNNNNNNNGG 1 cut(s) 9
Bse118I RCCGGY 1 cut(s) 302
Bse3DI GCAATG 1 cut(s) 282
BseBI CCWGG 1 cut(s) 298
BseDI CCNNGG 1 cut(s) 297
BseGI GGATG 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 9
BseMI GCAATG 1 cut(s) 282
BseMII CTCAG 2 cut(s) 5, 163
BseRI GAGGAG 1 cut(s) 66
BshFI GGCC 2 cut(s) 45, 302
BsiSI CCGG 1 cut(s) 303
BslFI GGGAC 1 cut(s) 307
BslI CCNNNNNNNGG 1 cut(s) 9
BsmFI GGGAC 1 cut(s) 307
BsnI GGCC 2 cut(s) 45, 302
BspACI CCGC 3 cut(s) 198, 201, 208
BspANI GGCC 2 cut(s) 45, 302
BspCNI CTCAG 2 cut(s) 6, 164
BspLI GGNNCC 1 cut(s) 295
BspMAI CTGCAG 1 cut(s) 269
BsrDI GCAATG 1 cut(s) 282
BsrFI RCCGGY 1 cut(s) 302
BssAI RCCGGY 1 cut(s) 302
BssECI CCNNGG 1 cut(s) 297
Bst2UI CCWGG 1 cut(s) 298
Bst4CI ACNGT 1 cut(s) 236
BstC8I GCNNGC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 14, 172
BstF5I GGATG 1 cut(s) 168
BstNI CCWGG 1 cut(s) 298
BstNSI RCATGY 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 296
BstSFI CTRYAG 1 cut(s) 265
BsuRI GGCC 2 cut(s) 45, 302
BtsCI GGATG 1 cut(s) 168
BtsI GCAGTG 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 262
Cac8I GCNNGC 1 cut(s) 36
CaiI CAGNNNCTG 1 cut(s) 264
Cfr10I RCCGGY 1 cut(s) 302
Cfr13I GGNCC 3 cut(s) 294, 300, 305
CviAII CATG 2 cut(s) 31, 94
CviJI RGCY 4 cut(s) 13, 45, 171, 302
CviKI_1 RGCY 4 cut(s) 13, 45, 171, 302
DdeI CTNAG 2 cut(s) 14, 172
EciI GGCGGA 1 cut(s) 216
Eco47I GGWCC 2 cut(s) 294, 305
Eco57I CTGAAG 1 cut(s) 98
EcoRII CCWGG 1 cut(s) 296
FaeI CATG 2 cut(s) 34, 97
FaiI YATR 2 cut(s) 32, 95
FaqI GGGAC 1 cut(s) 307
FatI CATG 2 cut(s) 30, 93
FblI GTMKAC 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 199
FokI GGATG 1 cut(s) 175
Fsp4HI GCNGC 1 cut(s) 199
GluI GCNGC 1 cut(s) 199
HaeIII GGCC 2 cut(s) 45, 302
HapII CCGG 1 cut(s) 303
Hin1II CATG 2 cut(s) 34, 97
HinfI GANTC 3 cut(s) 6, 100, 192
HpaII CCGG 1 cut(s) 303
HphI GGTGA 1 cut(s) 222
Hpy166II GTNNAC 3 cut(s) 21, 99, 110
Hpy188I TCNGA 1 cut(s) 260
Hpy188III TCNNGA 3 cut(s) 3, 222, 308
Hpy8I GTNNAC 3 cut(s) 21, 99, 110
Hpy99I CGWCG 1 cut(s) 51
HpyCH4III ACNGT 1 cut(s) 236
HpyCH4V TGCA 6 cut(s) 38, 93, 184, 247, 267, 282
HpyF3I CTNAG 2 cut(s) 14, 172
Hsp92II CATG 2 cut(s) 34, 97
LpnPI CCDG 4 cut(s) 101, 202, 253, 283
MaeIII GTNAC 1 cut(s) 69
MboII GAAGA 1 cut(s) 142
MlyI GAGTC 1 cut(s) 94
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 4 cut(s) 9, 44, 53, 71
MslI CAYNNNNRTG 1 cut(s) 287
MspI CCGG 1 cut(s) 303
MspR9I CCNGG 1 cut(s) 298
MvaI CCWGG 1 cut(s) 298
NlaIII CATG 2 cut(s) 34, 97
NlaIV GGNNCC 1 cut(s) 295
NmuCI GTSAC 1 cut(s) 69
NspI RCATGY 1 cut(s) 97
PcsI WCGNNNNNNNCGW 1 cut(s) 55
PfeI GAWTC 2 cut(s) 6, 192
PkrI GCNGC 1 cut(s) 200
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
Psp6I CCWGG 1 cut(s) 296
PspGI CCWGG 1 cut(s) 296
PspN4I GGNNCC 1 cut(s) 295
PspPI GGNCC 3 cut(s) 294, 300, 305
PsrI GAACNNNNNNTAC 2 cut(s) 11, 43
PstI CTGCAG 1 cut(s) 269
PstNI CAGNNNCTG 1 cut(s) 264
RseI CAYNNNNRTG 1 cut(s) 287
SatI GCNGC 1 cut(s) 199
Sau96I GGNCC 3 cut(s) 294, 300, 305
SchI GAGTC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 298
SetI ASST 3 cut(s) 20, 120, 191
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 2 cut(s) 294, 305
SmiMI CAYNNNNRTG 1 cut(s) 287
SsiI CCGC 3 cut(s) 198, 201, 208
StyD4I CCNGG 1 cut(s) 296
TaaI ACNGT 1 cut(s) 236
TaqI TCGA 2 cut(s) 49, 58
TauI GCSGC 1 cut(s) 201
TfiI GAWTC 2 cut(s) 6, 192
TscAI CASTG 1 cut(s) 269
TseFI GTSAC 1 cut(s) 69
Tsp45I GTSAC 1 cut(s) 69
TspDTI ATGAA 1 cut(s) 19
TspRI CASTG 1 cut(s) 269
VpaK11BI GGWCC 2 cut(s) 294, 305
XceI RCATGY 1 cut(s) 97
XmiI GTMKAC 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.