MD14G1199600.v1.1

60S ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0001880
Physical Location & Seq
Reverse (-)
28904212 .. 28906261
2050 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1199600.v1.1.491

Sequence Viewer

Length: 366 bp
ATGGTTCAGAGGCTCACATACCGTACGCGCCACAGCTACGCAACCAAGTCGAACCAACATCGGATCGTCAAAACCCCTGGTGGAAAGCTCGTGTATCAGACCAGTAAGAAGAGAGCAAGTGGACCAAAATGTCCTGTTACCGGAAAGAGAATCCAAGGGATTCCTCACTTGAGACCCGCTGAATATAAGAGGTCTAGACTGTCAAGGAACAGGAGGACCGTGAATCGTGCCTATGGGGGTGTGCTGTCCGGTGGAGCTGTCAGAGAGAGGATCATCCGAGCCTTTTTGGTGGAGGAGCAGAAGATCGTGAAGAAGGTTTTGAAGATTCAGAAGGCAAAAGAAAAGCAGGCGTCCAAAAGCAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L34e

Protein Analysis

122

Amino Acids

13.82

Weight (kDa)

11.6

Isoelectric Point (pI)

38.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L34e PF01199 1 - 96 3.9e-38 Ribosomal protein L34e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 129
AccII CGCG 1 cut(s) 28
AciI CCGC 1 cut(s) 177
AclWI GGATC 2 cut(s) 71, 278
AcyI GRCGYC 1 cut(s) 350
AfaI GTAC 1 cut(s) 25
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 322
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 3 cut(s) 36, 88, 257
AluI AGCT 3 cut(s) 36, 88, 257
Alw26I GTCTC 1 cut(s) 166
AlwI GGATC 2 cut(s) 71, 278
AspLEI GCGC 1 cut(s) 30
AspS9I GGNCC 2 cut(s) 122, 216
AvaII GGWCC 2 cut(s) 122, 216
BauI CACGAG 1 cut(s) 89
BcgI CGANNNNNNTGC 2 cut(s) 30, 64
BciT130I CCWGG 1 cut(s) 78
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 1 cut(s) 195
Bme1390I CCNGG 1 cut(s) 78
Bme18I GGWCC 2 cut(s) 122, 216
BmgT120I GGNCC 2 cut(s) 122, 216
BmrFI CCNGG 1 cut(s) 78
BpuEI CTTGAG 1 cut(s) 190
BsaHI GRCGYC 1 cut(s) 350
BsaI GGTCTC 1 cut(s) 166
BsaJI CCNNGG 2 cut(s) 76, 154
BsaWI WCCGGW 2 cut(s) 140, 248
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse1I ACTGG 1 cut(s) 102
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 2 cut(s) 76, 154
BseGI GGATG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 102
BseRI GAGGAG 1 cut(s) 308
Bsh1236I CGCG 1 cut(s) 28
BsiSI CCGG 2 cut(s) 141, 249
BsiWI CGTACG 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 140
BsmAI GTCTC 1 cut(s) 166
Bso31I GGTCTC 1 cut(s) 166
Bsp143I GATC 3 cut(s) 63, 270, 303
BspACI CCGC 1 cut(s) 177
BspFNI CGCG 1 cut(s) 28
BspPI GGATC 2 cut(s) 71, 278
BspTNI GGTCTC 1 cut(s) 166
BsrI ACTGG 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 76, 154
BssMI GATC 3 cut(s) 63, 270, 303
BssNI GRCGYC 1 cut(s) 350
BssSI CACGAG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 154
Bst2BI CACGAG 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 3 cut(s) 23, 201, 220
Bst6I CTCTTC 1 cut(s) 104
BstACI GRCGYC 1 cut(s) 350
BstC8I GCNNGC 1 cut(s) 348
BstF5I GGATG 1 cut(s) 273
BstFNI CGCG 1 cut(s) 28
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 3 cut(s) 66, 273, 306
BstMAI GTCTC 1 cut(s) 166
BstMBI GATC 3 cut(s) 63, 270, 303
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
BstUI CGCG 1 cut(s) 28
BtsCI GGATG 1 cut(s) 273
Cac8I GCNNGC 1 cut(s) 348
CfoI GCGC 1 cut(s) 30
Cfr13I GGNCC 2 cut(s) 122, 216
CseI GACGC 1 cut(s) 339
Csp6I GTAC 1 cut(s) 24
CviJI RGCY 5 cut(s) 13, 36, 88, 257, 281
CviKI_1 RGCY 5 cut(s) 13, 36, 88, 257, 281
CviQI GTAC 1 cut(s) 24
DpnI GATC 3 cut(s) 65, 272, 305
DpnII GATC 3 cut(s) 63, 270, 303
DrdI GACNNNNNNGTC 1 cut(s) 129
DseDI GACNNNNNNGTC 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
Eco130I CCWWGG 1 cut(s) 154
Eco31I GGTCTC 1 cut(s) 166
Eco47I GGWCC 2 cut(s) 122, 216
EcoRII CCWGG 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 154
FaiI YATR 3 cut(s) 19, 186, 234
FauI CCCGC 1 cut(s) 184
FokI GGATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 195
GlaI GCGC 1 cut(s) 29
HapII CCGG 2 cut(s) 141, 249
HgaI GACGC 1 cut(s) 339
HhaI GCGC 1 cut(s) 30
Hin1I GRCGYC 1 cut(s) 350
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 4 cut(s) 150, 160, 223, 325
HpaII CCGG 2 cut(s) 141, 249
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 6 cut(s) 9, 63, 99, 263, 278, 330
Hpy188III TCNNGA 2 cut(s) 195, 307
Hpy8I GTNNAC 1 cut(s) 122
HpyAV CCTTC 2 cut(s) 307, 325
HpyCH4III ACNGT 3 cut(s) 23, 201, 220
Hsp92I GRCGYC 1 cut(s) 350
HspAI GCGC 1 cut(s) 28
Kzo9I GATC 3 cut(s) 63, 270, 303
LmnI GCTCC 2 cut(s) 254, 295
LpnPI CCDG 8 cut(s) 63, 90, 115, 147, 154, 196, 262, 332
MaeI CTAG 1 cut(s) 195
MaeIII GTNAC 1 cut(s) 136
MalI GATC 3 cut(s) 65, 272, 305
MboI GATC 3 cut(s) 63, 270, 303
MboII GAAGA 4 cut(s) 121, 313, 322, 334
MnlI CCTC 6 cut(s) 3, 174, 183, 207, 261, 286
MspA1I CMGCKG 1 cut(s) 179
MspI CCGG 2 cut(s) 141, 249
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
MvnI CGCG 1 cut(s) 28
NdeII GATC 3 cut(s) 63, 270, 303
PfeI GAWTC 4 cut(s) 150, 160, 223, 325
Pfl23II CGTACG 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspLI CGTACG 1 cut(s) 23
PspPI GGNCC 2 cut(s) 122, 216
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
Sau3AI GATC 3 cut(s) 63, 270, 303
Sau96I GGNCC 2 cut(s) 122, 216
ScrFI CCNGG 1 cut(s) 78
SetI ASST 5 cut(s) 38, 90, 194, 259, 318
SinI GGWCC 2 cut(s) 122, 216
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
SsiI CCGC 1 cut(s) 177
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 76
StyI CCWWGG 1 cut(s) 154
TaaI ACNGT 3 cut(s) 23, 201, 220
TaqI TCGA 1 cut(s) 50
TfiI GAWTC 4 cut(s) 150, 160, 223, 325
VpaK11BI GGWCC 2 cut(s) 122, 216
XbaI TCTAGA 1 cut(s) 194
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.