MD15G1110900.v1.1

cwf21 domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
7747045 .. 7748421
1377 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1110900.v1.1.491

Sequence Viewer

Length: 480 bp
ATGGAGGAAGAATGGGGAAATAAGGATGTGGATAGAGATAAGGATTACAAGAGAGCAAAATATGATGATTCTAGATCAAATGAGAGGAGGCACAAAAGTGAAAAACGCAATGGAAGAGATGAAGAGGATCATGGAGGGCGTGGAAGGTATGACAGGGATGAAGAGTATAAAGGAAGGAAGCATGAAAGAGATGAAGGGGAAAATGAGTACAGAAAGGTGGAGGATAAAAAAGAGGAGCTTGGAAATGGAAAACCTGGAAAAATGGAGGAAGAACGGGGAAATAAGGATTTGGATTACAGGAGAGCAAAGTATGATGATTCTAGATCAAATGAGAGGAGGCGTGGAAGTGAAAAGCATAACGAAGATGATAAAAATTATAGAAAGCATGGAGAGGATGTTGAAGAGGAGCGTGGGAGTAGAAGGCACGGAAAAGTCGATGAAGAAAGAGGAAGTAGGGAGACTGAAGGAGAGACAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

160

Amino Acids

19.22

Weight (kDa)

5.7

Isoelectric Point (pI)

67.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 135
AfaI GTAC 1 cut(s) 209
AgsI TTSAA 1 cut(s) 401
AjnI CCWGG 1 cut(s) 253
AleI CACNNNNGTG 1 cut(s) 96
AluBI AGCT 2 cut(s) 238, 476
AluI AGCT 2 cut(s) 238, 476
Alw26I GTCTC 2 cut(s) 452, 464
AlwI GGATC 1 cut(s) 135
BciT130I CCWGG 1 cut(s) 255
BcoDI GTCTC 2 cut(s) 452, 464
BfaI CTAG 2 cut(s) 72, 321
Bme1390I CCNGG 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 255
BsaXI ACNNNNNCTCC 2 cut(s) 381, 411
Bse3DI GCAATG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 255
BseGI GGATG 3 cut(s) 31, 163, 400
BseMI GCAATG 1 cut(s) 115
BseRI GAGGAG 4 cut(s) 100, 248, 349, 419
BsmAI GTCTC 2 cut(s) 452, 464
Bsp143I GATC 3 cut(s) 74, 127, 323
BspPI GGATC 1 cut(s) 135
BsrDI GCAATG 1 cut(s) 115
BssMI GATC 3 cut(s) 74, 127, 323
Bst2UI CCWGG 1 cut(s) 255
Bst6I CTCTTC 4 cut(s) 109, 117, 156, 396
BstF5I GGATG 3 cut(s) 31, 163, 400
BstKTI GATC 3 cut(s) 77, 130, 326
BstMAI GTCTC 2 cut(s) 452, 464
BstMBI GATC 3 cut(s) 74, 127, 323
BstNI CCWGG 1 cut(s) 255
BstSCI CCNGG 1 cut(s) 253
BtsCI GGATG 3 cut(s) 31, 163, 400
Csp6I GTAC 1 cut(s) 208
CviAII CATG 3 cut(s) 131, 182, 386
CviJI RGCY 2 cut(s) 238, 476
CviKI_1 RGCY 2 cut(s) 238, 476
CviQI GTAC 1 cut(s) 208
DpnI GATC 3 cut(s) 76, 129, 325
DpnII GATC 3 cut(s) 74, 127, 323
Eam1104I CTCTTC 4 cut(s) 109, 117, 156, 396
EarI CTCTTC 4 cut(s) 109, 117, 156, 396
EcoRII CCWGG 1 cut(s) 253
FaeI CATG 3 cut(s) 134, 185, 389
FaiI YATR 9 cut(s) 63, 132, 150, 168, 183, 312, 357, 378, 387
FalI AAGNNNNNCTT 2 cut(s) 222, 254
FatI CATG 3 cut(s) 130, 181, 385
FokI GGATG 3 cut(s) 38, 170, 407
FspBI CTAG 2 cut(s) 72, 321
Hin1II CATG 3 cut(s) 134, 185, 389
HinfI GANTC 2 cut(s) 68, 317
Hpy188III TCNNGA 2 cut(s) 72, 321
HpyAV CCTTC 5 cut(s) 138, 168, 188, 414, 458
Hsp92II CATG 3 cut(s) 134, 185, 389
Kzo9I GATC 3 cut(s) 74, 127, 323
LmnI GCTCC 2 cut(s) 235, 406
LpnPI CCDG 4 cut(s) 139, 240, 267, 283
MaeI CTAG 2 cut(s) 72, 321
MalI GATC 3 cut(s) 76, 129, 325
MboI GATC 3 cut(s) 74, 127, 323
MboII GAAGA 8 cut(s) 20, 126, 134, 173, 281, 374, 413, 452
MluCI AATT 1 cut(s) 373
MslI CAYNNNNRTG 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 255
MvaI CCWGG 1 cut(s) 255
NdeII GATC 3 cut(s) 74, 127, 323
NlaIII CATG 3 cut(s) 134, 185, 389
OliI CACNNNNGTG 1 cut(s) 96
PcsI WCGNNNNNNNCGW 1 cut(s) 432
PfeI GAWTC 2 cut(s) 68, 317
Psp6I CCWGG 1 cut(s) 253
PspGI CCWGG 1 cut(s) 253
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
RseI CAYNNNNRTG 1 cut(s) 96
Sau3AI GATC 3 cut(s) 74, 127, 323
ScrFI CCNGG 1 cut(s) 255
SetI ASST 5 cut(s) 149, 219, 240, 256, 478
SmiMI CAYNNNNRTG 1 cut(s) 96
Sse9I AATT 1 cut(s) 373
SspMI CTAG 2 cut(s) 72, 321
StyD4I CCNGG 1 cut(s) 253
TaqI TCGA 1 cut(s) 435
TasI AATT 1 cut(s) 373
TatI WGTACW 1 cut(s) 207
TfiI GAWTC 2 cut(s) 68, 317
TspDTI ATGAA 5 cut(s) 135, 174, 198, 207, 453
TspGWI ACGGA 1 cut(s) 441
XbaI TCTAGA 2 cut(s) 71, 320
XspI CTAG 2 cut(s) 72, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.